FOXP1 (NM_001012505) Human 3' UTR Clone

CAT#: SC200190

3' UTR clone of forkhead box P1 (FOXP1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FOXP1 (NM_001012505) Human 3' UTR Clone
Vector pMirTarget
Synonyms 12CC4; hFKH1B; HSPC215; MFH; QRF1
ACCN NM_001012505
Insert Size 52 bp
Sequence Data
>SC200190 3’UTR clone of NM_001012505
The sequence shown below is from the reference sequence of NM_001012505. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGTGTCAGCCTAACCCTTCCCCATTTTGAATAAAATTATTCTTTGGAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001012505.2
Synonyms 12CC4; hFKH1B; HSPC215; MFH; QRF1
Summary This gene belongs to subfamily P of the forkhead box (FOX) transcription factor family. Forkhead box transcription factors play important roles in the regulation of tissue- and cell type-specific gene transcription during both development and adulthood. Forkhead box P1 protein contains both DNA-binding- and protein-protein binding-domains. This gene may act as a tumor suppressor as it is lost in several tumor types and maps to a chromosomal region (3p14.1) reported to contain a tumor suppressor gene(s). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Locus ID 27086
MW 1.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...