ST6GAL2 (NM_001142352) Human 3' UTR Clone

CAT#: SC200188

3' UTR clone of ST6 beta-galactosamide alpha-26-sialyltranferase 2 (ST6GAL2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ST6GAL2 (NM_001142352) Human 3' UTR Clone
Vector pMirTarget
Synonyms SIAT2; ST6GalII
ACCN NM_001142352
Insert Size 96 bp
Sequence Data
>SC200188 3’UTR clone of NM_001142352
The sequence shown below is from the reference sequence of NM_001142352. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACTGCACTCCAGCCTGGACGACAGAGTGAGACTCCATCTCAAAAAAAAAAAAAAAACTGGCCATATAA
GAAACTTAACATTCATACTGTTTAAAG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001142352.2
Synonyms SIAT2; ST6GalII
Summary This locus encodes a sialyltransferase. The encoded type II transmembrane protein catalyzes the transfer of sialic acid from CMP to an oligosaccharide substrate. Polymorphisms at this locus may be associated with variations in risperidone response in schizophrenic patients. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Locus ID 84620
MW 3.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...