ELOB (NM_207013) Human 3' UTR Clone

CAT#: SC200185

3' UTR clone of transcription elongation factor B (SIII) polypeptide 2 (18kDa elongin B) (TCEB2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ELOB (NM_207013) Human 3' UTR Clone
Vector pMirTarget
Synonyms SIII; TCEB2
ACCN NM_207013
Insert Size 88 bp
Sequence Data
>SC200185 3’UTR clone of NM_207013
The sequence shown below is from the reference sequence of NM_207013. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACACAGGTCCACCCACGCTGGGGGCTGTAATCACGGAGGGAAGTGGCTGCCCCCTTAACACACCTTTAA
TAAACAGTCTACAGACCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_207013.3
Synonyms SIII; TCEB2
Summary This gene encodes the protein elongin B, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. Pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, Aug 2008]
Locus ID 6923
MW 3.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...