LIM1 (LHX1) (NM_005568) Human 3' UTR Clone

Specifications

Product Data
Product Name	LIM1 (LHX1) (NM_005568) Human 3' UTR Clone
Vector	pMirTarget
Synonyms	LIM-1; LIM1
ACCN	NM_005568
Insert Size	66 bp
Sequence Data	Insert Sequence (showhide) >SC200180 3' UTR clone of NM_005568 The sequence shown below is from the reference sequence of NM_005568. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CCCGAAATGAACGAGGCGGCCGTGTGGTAGCGGGGTCTCGCACGGTCTGCGGAGTTCGTGGTTGTA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites	SgfI-MluI
OTI Disclaimer	Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq	NM_005568.2
Synonyms	LIM-1; LIM1
Summary	This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor important for the development of the renal and urogenital systems. This gene is a candidate for Mayer-Rokitansky-Kuster-Hauser syndrome, a disorder characterized by anomalies in the female genital tract. [provided by RefSeq, Dec 2010]
Locus ID	3975

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.