EEF1B2 (NM_001037663) Human 3' UTR Clone

CAT#: SC200162

3' UTR clone of eukaryotic translation elongation factor 1 beta 2 (EEF1B2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name EEF1B2 (NM_001037663) Human 3' UTR Clone
Vector pMirTarget
Synonyms EEF1B; EEF1B1; EF1B
ACCN NM_001037663
Insert Size 75 bp
Sequence Data
>SC200162 3’UTR clone of NM_001037663
The sequence shown below is from the reference sequence of NM_001037663. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGGATGTGGCTGCTTTCAACAAGATCTAAAATCCATCCTGGATCATGGCATTTAAATAAAAGATTGAA
AGATTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001037663.2
Synonyms EEF1B; EEF1B1; EF1B
Summary This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR. [provided by RefSeq, Jul 2008]
Locus ID 1933
MW 3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...