H2BC8 (NM_003518) Human 3' UTR Clone

CAT#: SC200146

3' UTR clone of histone cluster 1 H2bg (HIST1H2BG) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name H2BC8 (NM_003518) Human 3' UTR Clone
Vector pMirTarget
Synonyms dJ221C16.8; H2B.1A; H2B/a; H2BC4; H2BC6; H2BC7; H2BC10; H2BFA; HIST1H2BG
ACCN NM_003518
Insert Size 93 bp
Sequence Data
>SC200146 3’UTR clone of NM_003518
The sequence shown below is from the reference sequence of NM_003518. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGTCACCAAGTATACAAGCTCCAAGTAAATGTGTGCTTAGGTGCTTTAAAACTCAAAGGCTCTTTTC
AGAGCCACTCAAGTCTCACATAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003518.4
Synonyms dJ221C16.8; H2B.1A; H2B/a; H2BC4; H2BC6; H2BC7; H2BC10; H2BFA; HIST1H2BG
Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. The protein has antibacterial and antifungal antimicrobial activity. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]
Locus ID 8339
MW 3.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...