SLC39A6 (NM_001099406) Human 3' UTR Clone

CAT#: SC200142

3' UTR clone of solute carrier family 39 (zinc transporter) member 6 (SLC39A6) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SLC39A6 (NM_001099406) Human 3' UTR Clone
Vector pMirTarget
Synonyms LIV-1; ZIP6
ACCN NM_001099406
Insert Size 83 bp
Sequence Data
>SC200142 3’UTR clone of NM_001099406
The sequence shown below is from the reference sequence of NM_001099406. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTTGCTCTGGTTGATATGGTAAGTTTTTAAGAAGTCTTATTACATTATTGACCAACAATAAAATAGAGA
AAATATTCGGTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001099406.2
Synonyms LIV-1; ZIP6
Summary Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A6 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
Locus ID 25800
MW 3.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...