Peroxiredoxin 4 (PRDX4) (NM_006406) Human 3' UTR Clone

CAT#: SC200136

3' UTR clone of peroxiredoxin 4 (PRDX4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Peroxiredoxin 4 (PRDX4) (NM_006406) Human 3' UTR Clone
Vector pMirTarget
Synonyms AOE37-2; AOE372; HEL-S-97n; PRX-4
ACCN NM_006406
Insert Size 92 bp
Sequence Data
>SC200136 3’UTR clone of NM_006406
The sequence shown below is from the reference sequence of NM_006406. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGCTGAAGTATTTCGATAAACTGAATTGAGAAATACTTCTTCAAGTTATGATGCTTGAAAGTTCTCAA
TAAAGTTCACGGTTTCATTACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006406.2
Synonyms AOE37-2; AOE372; HEL-S-97n; PRX-4
Summary The protein encoded by this gene is an antioxidant enzyme and belongs to the peroxiredoxin family. The protein is localized to the cytoplasm. Peroxidases of the peroxiredoxin family reduce hydrogen peroxide and alkyl hydroperoxides to water and alcohol with the use of reducing equivalents derived from thiol-containing donor molecules. This protein has been found to play a regulatory role in the activation of the transcription factor NF-kappaB. [provided by RefSeq, Jul 2008]
Locus ID 10549
MW 3.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...