FAU (NM_001997) Human 3' UTR Clone

CAT#: SC200133

3' UTR clone of Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (FAU) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FAU (NM_001997) Human 3' UTR Clone
Vector pMirTarget
Synonyms asr1; FAU1; Fub1; Fubi; MNSFbeta; RPS30; S30
ACCN NM_001997
Insert Size 81 bp
Sequence Data
>SC200133 3’UTR clone of NM_001997
The sequence shown below is from the reference sequence of NM_001997. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAAGAAGGGCCCCAATGCCAACTCTTAAGTCTTTTGTAATTCTGGCTTTCTCTAATAAAAAAGCCAC
TTAGTTCAGTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001997.5
Synonyms asr1; FAU1; Fub1; Fubi; MNSFbeta; RPS30; S30
Summary This gene is the cellular homolog of the fox sequence in the Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV). It encodes a fusion protein consisting of the ubiquitin-like protein fubi at the N terminus and ribosomal protein S30 at the C terminus. It has been proposed that the fusion protein is post-translationally processed to generate free fubi and free ribosomal protein S30. Fubi is a member of the ubiquitin family, and ribosomal protein S30 belongs to the S30E family of ribosomal proteins. Whereas the function of fubi is currently unknown, ribosomal protein S30 is a component of the 40S subunit of the cytoplasmic ribosome and displays antimicrobial activity. Pseudogenes derived from this gene are present in the genome. Similar to ribosomal protein S30, ribosomal proteins S27a and L40 are synthesized as fusion proteins with ubiquitin. [provided by RefSeq, Nov 2014]
Locus ID 2197
MW 2.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...