EPB41 (NM_001166006) Human 3' UTR Clone

CAT#: SC200119

3' UTR clone of erythrocyte membrane protein band 4.1 (elliptocytosis 1 RH-linked) (EPB41) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name EPB41 (NM_001166006) Human 3' UTR Clone
Vector pMirTarget
Synonyms 4.1R; EL1; HE
ACCN NM_001166006
Insert Size 72 bp
Sequence Data
>SC200119 3’UTR clone of NM_001166006
The sequence shown below is from the reference sequence of NM_001166006. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAGAAGGAGTGAGTACTTTGTCCACATGACCAATTGTGAAAATGGAGGGAATAAATGTTTTTATGTAT
TAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001166006.2
Synonyms 4.1R; EL1; HE
Summary The protein encoded by this gene, together with spectrin and actin, constitute the red cell membrane cytoskeletal network. This complex plays a critical role in erythrocyte shape and deformability. Mutations in this gene are associated with type 1 elliptocytosis (EL1). Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Oct 2009]
Locus ID 2035
MW 2.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...