Dopamine Receptor D3 (DRD3) (NM_001282563) Human Untagged Clone

CAT#: SC335870

DRD3 (untagged) - Human dopamine receptor D3 (DRD3), transcript variant f



  "NM_001282563" in other vectors (2)

CNY 3,800.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
DRD3 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms D3DR; ETM1; FET1
Vector pCMV6-Entry
Sequence Data
>SC335870 representing NM_001282563.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCATCTCTGAGCCAGCTGAGTGGCCACCTGAACTACACCTGTGGGGCAGAGAACTCCACAGGTGCC
AGCCAGGCCCGCCCACATGCCTACTATGCCCTCTCCTACTGCGCGCTCATCCTGGCCATCGTCTTCGGC
AATGGCCTGGTGTGCATGGCTGTGCTGAAGGAGCGGGCCCTGCAGACTACCACCAACTACTTAGTAGTG
AGCCTGGCTGTGGCAGACTTGCTGGTGGCCACCTTGGTGATGCCCTGGGTGGTATACCTGGAGGTGACA
GGTGGAGTCTGGAATTTCAGCCGCATTTGCTGTGATGTTTTTGTCACCCTGGATGTCATGATGTGTACA
GCCAGCATCCTTAATCTCTGTGCCATCAGCATAGACAGGTACACTGCAGTGGTCATGCCCGTTCACTAC
CAGCATGGCACGGGACAGAGCTCCTGTCGGCGCGTGGCCCTCATGATCACGGCCGTCTGGGTACTGGCC
TTTGCTGTGTCCTGCCCTCTTCTGTTTGGCTTTAATACCACAGGGGACCCCACTGTCTGCTCCATCTCC
AACCCTGATTTTGTCATCTACTCTTCAGTGGTGTCCTTCTACCTGCCCTTTGGAGTGACTGTCCTTGTC
TATGCCAGAATCTATGTGGTGCTGAAACAAAGGAGACGGAAAAGGATCCTCACTCGACAGAACAGTCAG
TGCAACAGTGTCAGGCCTGGCTTCCCCCAACAAACCCTCTCTCCTGACCCGGCACATCTGGAGCTGAAG
CGTTACTACAGCATCTGCCAGGACACTGCCTTGGGTGGACCAGGCTTCCAAGAAAGAGGAGGAGAGTTG
AAAAGAGAGGAGAAGACTCGGAATTCCCTGAGTCCCACCATAGCGCCCAAGCTCAGCTTAGAAGTTCGA
AAACTCAGCAATGGCAGATTATCGACATCTTTGAAGCTGGGGCCCCTGCAACCTCGGGGAGTGCCACTT
CGGGAGAAGAAGGCAACCCAAATGGTGGCCATTGTGCTTGGGGCCTTCATTGTCTGCTGGCTGCCCTTC
TTCTTGACCCATGTTCTCAATACCCACTGCCAGACATGCCACGTGTCCCCAGAGCTTTACAGTGCCACG
ACATGGCTGGGCTACGTGAATAGCGCCCTCAACCCTGTGATCTATACCACCTTCAATATCGAGTTCCGG
AAAGCCTTCCTCAAGATCCTGTCTTGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001282563
Insert Size 1203 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282563.2
RefSeq Size 1557 bp
RefSeq ORF 1203 bp
Locus ID 1814
UniProt ID P35462
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
MW 44.2 kDa
Gene Summary This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (f) differs in the 5' UTR compared to variant a. Variants a, f and g encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...