Adiponectin Receptor 1 (ADIPOR1) (NM_001290557) Human Untagged Clone

CAT#: SC335718

ADIPOR1 (untagged) - Human adiponectin receptor 1 (ADIPOR1), transcript variant 3



  "NM_001290557" in other vectors (2)

CNY 3,610.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-ADIPOR1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACDCR1; CGI-45; CGI45; PAQR1; TESBP1A
Vector pCMV6-Entry
Sequence Data
>SC335718 representing NM_001290557.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTTCCCACAAAGGATCTGTGGTGGCACAGGGGAATGGGGCTCCTGCCAGTAACAGGGAAGCTGAC
ACGGTGGAACTGGCTGAACTGGGACCCCTGCTAGAAGAGAAGGGCAAACGGGTAATCGCCAACCCACCC
AAAGCTGAAGAAGAGCAAACATGCCCAGTGCCCCAGGAAGAAGAGGAGGAGGTGCGGGTACTGACACTT
CCCCTGCAAGCCCACCACGCCATGGAGAAGATGGAAGAGTTTGTGTACAAGGTCTGGGAGGGACGTTGG
AGGGTCATCCCATATGATGTGCTCCCTGACTGGCTAAAGGACAACGACTATCTGCTACATGGTCATAGA
CCTCCCATGCCCTCCTTTCGGGCTTGCTTCAAGAGCATCTTCCGCATTCATACAGAAACTGGCAACATC
TGGACCCATCTGCTTGGTTTCGTGCTGTTTCTCTTTTTGGGAATCTTGACCATGCTCAGACCAAATATG
TACTTCATGGCCCCTCTACAGGAGAAGGTGGTTTTTGGGATGTTCTTTTTGGGTGCAGTGCTCTGCCTC
AGCTTCTCCTGGCTCTTTCACACCGTCTATTGTCATTCAGAGAAAGTCTCTCGGACTTTTTCCAAACTG
GACTATTCAGGGATTGCTCTTCTAATTATGGGGAGCTTTGTCCCCTGGCTCTATTATTCCTTCTACTGC
TCCCCACAGCCACGGCTCATCTACCTCTCCATCGTCTGTGTCCTGGGCATTTCTGCCATCATTGTGGCG
CAGTGGGACCGGTTTGCCACTCCTAAGCACCGGCAGACAAGAGCAGGCGTGTTCCTGGGACTTGGCTTG
AGTGGCGTCGTGCCCACCATGCACTTTACTATCGCTGAGGGCTTTGTCAAGGCCACCACAGTGGGCCAG
ATGGGCTGGTTCTTCCTCATGGCTGTGATGTACATCACTGGAGCTGGCCTTTATGCTGCTCGAATTCCT
GAGCGCTTCTTTCCTGGAAAATTTGACATATGGTTCCAGTCTCATCAGATTTTCCATGTCCTGGTGGTG
GCAGCAGCCTTTGTCCACTTCTATGGAGTCTCCAACCTTCAGGAATTCCGTTACGGCCTAGAAGGCGGC
TGTACTGATGACACCCTTCTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001290557
Insert Size 1128 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290557.1
RefSeq Size 2251 bp
RefSeq ORF 1128 bp
Locus ID 51094
UniProt ID Q96A54
Protein Families Druggable Genome, Transmembrane
Protein Pathways Adipocytokine signaling pathway
MW 42.6 kDa
Gene Summary This gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. Binding of adiponectin to the encoded protein results in activation of an AMP-activated kinase signaling pathway which affects levels of fatty acid oxidation and insulin sensitivity. A pseudogene of this gene is located on chromosome 14. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (3, also known as R1T3) has an additional internal exon in the 5' UTR, compared to variant 1. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...