Serum Response Factor (SRF) (NM_001292001) Human Untagged Clone

CAT#: SC335217

SRF (untagged) - Human serum response factor (c-fos serum response element-binding transcription factor) (SRF), transcript variant 2



  "NM_001292001" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SRF Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MCM1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335217 representing NM_001292001.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATCACCAGTGAGACCGGCAAGGCACTGATTCAGACCTGCCTCAACTCGCCAGACTCTCCACCCCGT
TCAGACCCCACAACAGACCAGAGAATGAGTGCCACTGGCTTTGAAGAGACAGATCTCACCTACCAGGTG
TCGGAGTCTGACAGCAGTGGGGAGACCAAGGACACACTGAAGCCGGCGTTCACAGTCACCAACCTGCCG
GGTACAACCTCCACCATCCAAACAGCACCTAGCACCTCTACCACCATGCAAGTCAGCAGCGGCCCCTCC
TTTCCCATCACCAACTACCTGGCACCAGTGTCTGCTAGTGTCAGCCCCAGTGCTGTCAGCAGTGCCAAT
GGGACTGTGCTGAAGAGTACAGGCAGCGGCCCTGTCTCCTCTGGGGGCCTTATGCAGCTGCCTACCAGC
TTCACCCTCATGCCTGGTGGGGCAGTGGCCCAGCAGGTCCCAGTGCAGGCCATTCAAGTGCACCAGGCC
CCACAGCAAGCGTCTCCCTCCCGTGACAGCAGCACAGACCTCACGCAGACCTCCTCCAGCGGGACAGTG
ACGCTGCCCGCCACCATCATGACGTCATCCGTGCCCACAACTGTGGGTGGCCACATGATGTACCCTAGC
CCGCATGCGGTGATGTATGCCCCCACCTCGGGCCTGGGTGATGGCAGCCTCACCGTGCTGAATGCCTTC
TCCCAGGCACCATCCACCATGCAGGTGTCACACAGCCAGGTCCAGGAGCCAGGTGGCGTCCCCCAGGTG
TTCCTGACAGCATCATCTGGGACAGTGCAGATCCCTGTTTCAGCAGTTCAGCTCCACCAGATGGCTGTG
ATAGGGCAGCAGGCCGGGAGCAGCAGCAACCTCACCGAGCTACAGGTGGTGAACCTGGACACCGCCCAC
AGCACCAAGAGTGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001292001
Insert Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001292001.1
RefSeq Size 3417 bp
RefSeq ORF 915 bp
Locus ID 6722
UniProt ID P11831
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway
MW 31 kDa
Gene Summary This gene encodes a ubiquitous nuclear protein that stimulates both cell proliferation and differentiation. It is a member of the MADS (MCM1, Agamous, Deficiens, and SRF) box superfamily of transcription factors. This protein binds to the serum response element (SRE) in the promoter region of target genes. This protein regulates the activity of many immediate-early genes, for example c-fos, and thereby participates in cell cycle regulation, apoptosis, cell growth, and cell differentiation. This gene is the downstream target of many pathways; for example, the mitogen-activated protein kinase pathway (MAPK) that acts through the ternary complex factors (TCFs). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...