C22orf25 (TANGO2) (NM_001283154) Human Untagged Clone

CAT#: SC334844

TANGO2 (untagged) - Human transport and golgi organization 2 homolog (Drosophila) (TANGO2), transcript variant 6



  "NM_001283154" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TANGO2 Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C22orf25; MECRCN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001283154, the custom clone sequence may differ by one or more nucleotides


ATGTGCATCATCTTCTTTAAGTTTGATCCTCGCCCTGTTTCCAAAAACGCGTACAGGCTCATCTTGGCAG
CCAACAGGGATGAATTCTACAGCCGACCCTCCAAGTTAGCTGACTTCTGGGGGAACAACAACGAGATCCT
CAGTGGGCTGGACATGGAGGAAGGCAAGGAAGGAGGCACATGGCTGGGCATCAGCACACGTGGCAAGCTG
GCAGCACTCACCAACTACCTGCAGCCGCAGCTGGACTGGCAGGCCCGAGGGCGAGGTGAACTTGTCACCC
ACTTTCTGACCACTGACGTGGACAGCTTGTCCTACCTGAAGAAGGTCTCTATGGAGGGCCATCTGTACAA
TGGCTTCAACCTCATAGCAGCCGACCTGAGCACAGCAAAGGGAGACGTCATTTGCTACTATGGGAACCGA
GGGGAGCCTGATCCTATCGTTTTGACGCCAGGCACCTACGGGCTGAGCAACGCGCTGCTGGAGACTCCCT
GGAGGAAGCTGTGCTTTGGGAAGCAGCTCTTCCTGGAGGCTGTGGAACGGAGCCAGGCGCTGCCCAAGGA
TGTGCTCATCGCCAGCCTCCTGGATGTGCTCAACAATGAAGAGGCAGCTGCCAGACCCGGCCATCGAGGA
CCAGGGTGGGGAGTACGTGCAGCCCATGCTGAGCAAGTACGCGGCTGTGTGCGTGCGCTGCCCTGGCTAC
GGCACCAGAACCAACACTATCATCCTGGTAGATGCGGACGGCCACGTGACCTTCACTGA


Restriction Sites SgfI-RsrII     
ACCN NM_001283154
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001283154.2, NP_001270083.1
RefSeq Size 3548 bp
RefSeq ORF 759 bp
Locus ID 128989
UniProt ID Q6ICL3
Gene Summary This gene belongs to the transport and Golgi organization family, whose members are predicted to play roles in secretory protein loading in the endoplasmic reticulum. Depletion of this gene in Drosophila S2 cells causes fusion of the Golgi with the ER. In mouse tissue culture cells, this protein co-localizes with a mitochondrially targeted mCherry protein and displays very low levels of co-localization with Golgi and peroxisomes. Allelic variants of this gene are associated with rhabdomyolysis, metabolic crises with encephalopathy, and cardiac arrhythmia. [provided by RefSeq, Apr 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...