C18orf1 (LDLRAD4) (NM_001276249) Human Untagged Clone

CAT#: SC333222

LDLRAD4 (untagged) - Homo sapiens low density lipoprotein receptor class A domain containing 4 (LDLRAD4), transcript variant d1



  "NM_001276249" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


LDLRAD4 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C18orf1
Vector pCMV6-Entry
Sequence Data
>SC333222 representing NM_001276249.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGGTGGTCATCGTCTGCCTGCTGAACCACTACAAAGTCTCCACGCGGTCCTTCATCAACCGCCCG
AACCAGAGCCGGAGGCGGGAGGACGGGCTGCCGCAGGAAGGGTGCCTGTGGCCTTCAGACAGCGCCGCA
CCGCGGCTGGGCGCCTCGGAGATCATGCATGCCCCGCGGTCCAGGGACAGGTTCACAGCGCCGTCCTTC
ATCCAGAGGGATCGCTTCAGCCGCTTCCAGCCCACCTACCCCTATGTGCAGCACGAGATTGATCTTCCT
CCCACCATCTCCCTGTCCGACGGTGAAGAGCCACCTCCTTACCAGGGGCCCTGCACCCTGCAGCTCCGG
GACCCTGAACAGCAGATGGAACTCAACCGAGAGTCCGTGAGGGCCCCACCCAACCGAACCATATTTGAC
AGTGATTTAATAGACATTGCTATGTATAGCGGGGGTCCATGCCCACCCAGCAGCAACTCGGGCATCAGT
GCAAGCACCTGCAGCAGTAACGGGAGGATGGAGGGGCCACCCCCCACATACAGCGAGGTGATGGGCCAC
CACCCAGGCGCCTCTTTCCTCCATCACCAGCGCAGCAACGCACACAGGGGCAGCAGACTGCAGTTTCAG
CAGAACAATGCAGAGAGCACAATAGTACCCATCAAAGGCAAAGATAGGAAGCCTGGGAACCTGGTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001276249
Insert Size 690 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276249.1
RefSeq Size 8138 bp
RefSeq ORF 690 bp
Locus ID 753
UniProt ID O15165
Protein Families Druggable Genome, Transmembrane
MW 25.6 kDa
Gene Summary Functions as a negative regulator of TGF-beta signaling and thereby probably plays a role in cell proliferation, differentiation, apoptosis, motility, extracellular matrix production and immunosuppression. In the canonical TGF-beta pathway, ZFYVE9/SARA recruits the intracellular signal transducer and transcriptional modulators SMAD2 and SMAD3 to the TGF-beta receptor. Phosphorylated by the receptor, SMAD2 and SMAD3 then form a heteromeric complex with SMAD4 that translocates to the nucleus to regulate transcription. Through interaction with SMAD2 and SMAD3, LDLRAD4 may compete with ZFYVE9 and SMAD4 and prevent propagation of the intracellular signal.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (d1) contains an alternate 5' terminal exon, differs in its 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant a1. The encoded isoform (delta 1) is shorter at the N-terminus, compared to isoform alpha 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...