TEA domain family member 2 (TEAD2) (NM_001256661) Human Untagged Clone

CAT#: SC330476

TEAD2 (untagged) - Homo sapiens TEA domain family member 2 (TEAD2), transcript variant 4



  "NM_001256661" in other vectors (2)

CNY 4,370.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-TEAD2 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ETF; TEAD-2; TEF-4; TEF4
Vector pCMV6-Entry
Sequence Data
>SC330476 representing NM_001256661.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGGAACCCCGGGCTGGGGCCGCCCTGGACGATGGCAGCGGCTGGACGGGCAGTGAGGAAGGCAGT
GAGGAGGGTACCGGCGGCAGTGAGGGGGCTGGGGGTGACGGGGGCCCGGATGCAGAGGGGGTGTGGAGC
CCAGACATTGAGCAGAGCTTCCAGGAGGCCCTGGCCATCTATCCACCCTGCGGCCGCCGGAAAATAATT
TTGTCTGATGAAGGCAAGATGTATGGTCGGAATGAACTGATCGCCCGCTACATCAAGCTGAGAACGGGG
AAGACCCGAACTCGAAAACAGGTTTCTAGTCACATCCAGGTTTTGGCCCGAAGGAAATCAAGGGAAATC
CAGTCCAAGTTGAAGGCTCTGAACGTGGACCAGGTTTCCAAGGACAAGGCTTTCCAGACAATGGCAACC
ATGTCCTCTGCCCAGCTCATCTCCGCGCCTTCTCTGCAGGCCAAACTGGGTCCCACTGGTCCTCAGGCC
TCTGAGCTTTTCCAGTTTTGGTCTGGAGGATCTGGGCCCCCCTGGAATGTTCCAGATGTGAAGCCATTC
TCACAGACACCGTTCACCTTGTCACTGACTCCCCCATCTACTGACCTCCCAGGGTACGAGCCCCCCCAA
GCCCTCTCACCCCTGCCCCCACCTACCCCATCGCCCCCAGCCTGGCAGGCTCGGGGCCTGGGCACCGCC
CGGTTGCAGCTGGTAGAGTTCTCAGCCTTCGTGGAACCGCCAGATGCAGTTGATTCTTACCAGAGGCAC
CTGTTCGTGCACATCAGCCAGCACTGCCCCAGCCCCGGAGCGCCGCCGCTCGAGAGTGTGGACGTCCGG
CAGATCTACGACAAATTCCCTGAGAAAAAGGGTGGCCTCCGAGAGCTATATGATCGTGGCCCCCCCCAT
GCCTTCTTCCTGGTCAAGTTCTGGGCGGACCTGAACTGGGGCCCAAGTGGTGAGGAGGCAGGGGCCGGT
GGCAGCATCAGCAGTGGTGGCTTCTACGGAGTGAGCAGCCAGTATGAGAGCCTGGAACACATGACCCTC
ACCTGTTCCTCCAAGGTCTGCTCTTTTGGCAAGCAGGTGGTGGAGAAGGTGGAGACGGAACGGGCCCAG
CTGGAGGACGGCAGATTTGTGTACCGCCTGCTGCGCTCGCCCATGTGCGAGTACCTGGTGAATTTCTTG
CACAAGTTGCGGCAGCTGCCTGAGCGATACATGATGAACAGCGTCCTGGAAAACTTCACCATCCTCCAG
GTGGTGACAAACAGAGACACCCAGGAACTGCTGCTCTGCACCGCCTATGTCTTCGAGGTCTCCACCAGC
GAGCGTGGGGCCCAGCATCACATTTACCGCCTGGTCAGGGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256661
Insert Size 1356 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256661.1
RefSeq Size 2211 bp
RefSeq ORF 1356 bp
Locus ID 8463
UniProt ID Q15562
Protein Families Transcription Factors
MW 49.6 kDa
Gene Summary Transcription factor which plays a key role in the Hippo signaling pathway, a pathway involved in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein MST1/MST2, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Acts by mediating gene expression of YAP1 and WWTR1/TAZ, thereby regulating cell proliferation, migration and epithelial mesenchymal transition (EMT) induction. Binds to the SPH and GT-IIC 'enhansons' (5'-GTGGAATGT-3'). May be involved in the gene regulation of neural development. Binds to the M-CAT motif.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR, contains an alternate exon and uses an alternate splice site in the 5' coding region, but maintains the reading frame, compared to variant 1. Variants 3 and 4 encode the same isoform (2), which is longer than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它TEA domain family member 2产品

Customer Reviews 
Loading...