United States
Germany
Japan
United Kingdom
China
PRR7 (NM_001174101) Human Untagged Clone
CAT＃: SC328445
PRR7 (untagged)-Human proline rich 7 (synaptic) (PRR7) transcript variant 2
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001174101, the custom clone sequence may differ by one or more nucleotides
ATGGTGATGTCCCAGGGCACCTACACGTTCCTCACGTGCTTCGCCGGCTTCTGGCTCATC TGGGGTCTCATCGTCCTGCTCTGCTGCTTCTGCAGCTTCCTGCGCCGCCGCCTCAAACGG CGCCAGGAGGAGCGACTGCGCGAGCAGAACCTGCGCGCCCTAGAGCTGGAGCCCCTCGAA CTCGAGGGCAGTCTGGCCGGGAGCCCCCCGGGCCTGGCGCCGCCGCAGCCACCACCACAC CGTAGCCGCCTGGAGGCGCCGGCTCACGCGCACTCGCATCCGCACGTGCACGTGCACCCG CTGCTGCACCACGGGCCCGCGCAGCCGCACGCGCACGCGCACCCACACCCGCACCACCAC GCGCTCCCGCACCCGCCGCCTACGCACCTGTCGGTGCCGCCACGGCCCTGGAGCTACCCG CGCCAAGCGGAATCGGACATGTCCAAACCACCGTGTTACGAAGAGGCGGTGCTGATGGCA GAGCCGCCGCCGCCCTATAGCGAGGTGCTCACGGACACGCGCGGCCTCTACCGCAAGATC GTCACGCCCTTCCTGAGTCGCCGCGACAGCGCGGAGAAGCAGGAGCAGCCGCCTCCCAGC TACAAGCCGCTCTTCCTGGACCGGGGCTACACCTCGGCGCTGCACCTGCCCAGCGCCCCT CGGCCCGCGCCGCCCTGCCCAGCCCTCTGCCTGCAGGCCGACCGTGGCCGCCGGGTCTTC CCCAGCTGGACCGACTCAGAGCTCAGCAGCCGCGAGCCCCTGGAGCACGGAGCTTGGCGT CTGCCGGTCTCCATCCCCTTGTTCGGGAGGACTACAGCCGTATAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001174101 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001174101.1, NP_001167572.1 |
| RefSeq Size | 1458 bp |
| RefSeq ORF | 825 bp |
| Locus ID | 80758 |
| UniProt ID | Q8TB68 |
| Protein Families | Transmembrane |
| Gene Summary | Acts as a synapse-to-nucleus messenger to promote NMDA receptor-mediated excitotoxicity in neurons in a JUN-dependent manner (By similarity). Inhibits ubiquitination-mediated degradation and promotes phosphorylation and transcriptional activity of transcription factor JUN (PubMed:27458189). Might play a redundant role in the regulation of T cell receptor signaling (PubMed:21460222). Might promote apoptosis in T cells (PubMed:21460222).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All variants (1-3) encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229807 | PRR7 (Myc-DDK-tagged)-Human proline rich 7 (synaptic) (PRR7), transcript variant 2 |
CNY 3,990.00 |
|
| RC229807L3 | Lenti-ORF clone of PRR7 (Myc-DDK-tagged)-Human proline rich 7 (synaptic) (PRR7), transcript variant 2 |
CNY 5,890.00 |
|
| RC229807L4 | Lenti-ORF clone of PRR7 (mGFP-tagged)-Human proline rich 7 (synaptic) (PRR7), transcript variant 2 |
CNY 5,890.00 |
|
| RG229807 | PRR7 (tGFP-tagged) - Human proline rich 7 (synaptic) (PRR7), transcript variant 2 |
CNY 4,370.00 |
