RASSF8 (NM_001164748) Human Untagged Clone

CAT#: SC326968

RASSF8 (untagged)-Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8) transcript variant 3



  "NM_001164748" in other vectors (4)

CNY 6,750.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RASSF8 mouse monoclonal antibody, clone OTI1F5 (formerly 1F5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C12orf2; HOJ1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001164748, the custom clone sequence may differ by one or more nucleotides
ATGGAACTTAAAGTATGGGTGGATGGAGTTCAGAGGATTGTTTGTGGAGTCACTGAAGTC
ACAACTTGCCAGGAGGTTGTCATAGCCTTAGCTCAAGCAATAGGTCGAACTGGAAGGTAC
ACCCTTATAGAGAAATGGAGAGATACTGAAAGACACTTAGCACCTCATGAAAATCCTATC
ATATCCTTAAACAAATGGGGGCAGTATGCTAGTGATGTGCAGCTCATTCTACGACGAACT
GGGCCGTCTCTCAGTGAGCGACCCACTTCAGACAGTGTGGCTCGAATTCCTGAAAGAACT
TTATACAGGCAGAGTCTGCCCCCCTTAGCTAAACTGAGGCCTCAGATTGACAAATCAATC
AAAAGGAGGGAACCGAAAAGGAAATCACTGACATTTACAGGAGGTGCCAAAGGATTAATG
GACATTTTTGGAAAAGGTAAAGAAACTGAGTTTAAGCAAAAGGTGCTGAATAACTGCAAA
ACAACAGCAGATGAGTTGAAGAAGCTAATCCGTCTGCAGACAGAGAAGCTTCAATCCATT
GAGAAACAGCTGGAATCTAATGAAATAGAAATAAGATTTTGGGAGCAAAAGTATAATTCC
AACCTTGAAGAGGAAATTGTCCGTCTAGAGCAAAAGATCAAAAGAAACGATGTAGAAATT
GAGGAGGAAGAATTCTGGGAAAATGAATTACAGATTGAACAGGAAAATGAAAAACAGCTG
AAGGATCAACTTCAAGAAATAAGACAGAAAATAACAGAATGTGAAAACAAATTAAAGGAC
TATTTGGCACAGATCCGGACTATGGAAAGTGGTCTTGAAGCAGAAAAATTGCAACGGGAA
GTTCAAGAGGCACAGGTCAATGAGGAAGAGGTTAAAGGAAAGATCGGTAAGGTCAAAGGG
GAGATTGACATTCAAGGCCAGCAGAGTCTGAGGTTGGAAAATGGCATCAAAGCTGTGGAA
AGATCTCTTGGACAAGCCACCAAACGCTTACAGGACAAAGAACAGGAACTGGAGCAGTTG
ACTAAGGAGTTGCGGCAAGTCAATCTCCAGCAGTTCATCCAGCAGACAGGGACAAAAGTT
ACCGTTTTGCCAGCGGAGCCCATTGAAATAGAGGCCTCACATGCAGACATTGAAAGGGAG
GCACCATTCCAGTCTGGGTCCCTGAAGCGACCTGGTTCATCTCGGCAGCTCCCCAGTAAT
CTCCGCATTCTGCAGAATCCTATCTCATCTGGTTTTAATCCTGAAGGCATATATGTA
Restriction Sites Please inquire     
ACCN NM_001164748
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164748.1, NP_001158220.1
RefSeq Size 5561 bp
RefSeq ORF 1260 bp
Locus ID 11228
UniProt ID Q8NHQ8
Gene Summary This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...