MAGP1 (MFAP2) (NM_001135247) Human Untagged Clone
CAT#: SC324766
MFAP2 (untagged)-Human microfibrillar-associated protein 2 (MFAP2), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MAGP; MAGP-1; MAGP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324766 representing NM_001135247.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGAGCTGCCTACCTCTTCCTGCTATTCCTGCCTGGCTTGCTGGCTCAGGGCCAGTATGACCTGGAC CCGCTGCCGCCGTTCCCTGACCACGTCCAGTACACCCACTATAGCGACCAGATCGACAACCCAGACTAC TATGATTATCAAGAGGTGACTCCTCGGCCCTCCGAGGAACAGTTCCAGTTCCAGTCCCAGCAGCAAGTC CAACAGGAAGTCATCCCAGCCCCAACCCCAGAACCAGGAAATGCAGAGCTGGAGCCCACAGAGCCTGGG CCTCTTGACTGCCGTGAGGAACAGTACCCGTGCACCCGCCTCTACTCCATACACAGGCCTTGCAAACAG TGTCTCAACGAGGTCTGCTTCTACAGCCTCCGCCGTGTGTACGTCATTAACAAGGAGATCTGTGTTCGT ACAGTGTGTGCCCATGAGGAGCTCCTCCGAGCTGACCTCTGTCGGGACAAGTTCTCCAAATGTGGCGTG ATGGCCAGCAGCGGCCTGTGCCAATCCGTGGCGGCCTCCTGTGCCAGGAGCTGTGGGAGCTGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001135247 |
Insert Size | 549 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135247.1 |
RefSeq Size | 1102 bp |
RefSeq ORF | 549 bp |
Locus ID | 4237 |
UniProt ID | P55001 |
Protein Families | Secreted Protein |
MW | 20.8 kDa |
Gene Summary | Microfibrillar-associated protein 2 is a major antigen of elastin-associated microfibrils and a candidate for involvement in the etiology of inherited connective tissue diseases. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2008] Transcript Variant: This variant (3) uses an alternate in-frame splice site and differs in the 5' UTR compared to variant 2. The resulting isoform (b) has the same N- and C-termini but is one aa shorter compared to isoform a. Variants 3 and 4 both encode isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225196 | MFAP2 (Myc-DDK-tagged)-Human microfibrillar-associated protein 2 (MFAP2), transcript variant 3 |
CNY 2,400.00 |
|
RC225196L3 | Lenti ORF clone of Human microfibrillar-associated protein 2 (MFAP2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225196L4 | Lenti ORF clone of Human microfibrillar-associated protein 2 (MFAP2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG225196 | MFAP2 (tGFP-tagged) - Human microfibrillar-associated protein 2 (MFAP2), transcript variant 3 |
CNY 4,370.00 |