PIGA (NM_020473) Human Untagged Clone

CAT#: SC317265

PIGA (untagged)-Human phosphatidylinositol glycan anchor biosynthesis, class A (PIGA), transcript variant 3



  "NM_020473" in other vectors (5)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PIGA Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GPI3; MCAHS2; PIG-A; PNH1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_020473, the custom clone sequence may differ by one or more nucleotides
ATGGCGATCGTGGAAGCAGCCAGTTGTGGTTTACAGGTTGTAAGTACCAGAGTTGGTGGA
ATTCCTGAGGTGCTTCCAGAAAACCTTATTATTTTATGTGAGCCTTCAGTAAAATCTTTG
TGTGAAGGATTGGAAAAGGCTATTTTCCAACTGAAGTCAGGGACATTGCCAGCTCCAGAA
AACATCCATAACATAGTAAAGACTTTCTACACCTGGAGGAATGTTGCAGAAAGAACTGAA
AAGGTATATGACCGGGTATCAGTGGAAGCTGTGTTGCCAATGGACAAACGACTGGACAGA
CTTATTTCTCACTGCGGCCCAGTAACAGGCTACATCTTTGCTTTGTTGGCAGTTTTCAAC
TTCCTCTTCCTCATTTTCTTGAGATGGATGACTCCAGATTCTATCATTGATGTTGCAATA
GATGCCACTGGGCCACGGGGTGCCTGGACTAATAACTATTCTCACAGTAAAAGAGGGGGT
GAGAATAATGAGATATCTGAAACCAGG
Restriction Sites Please inquire     
ACCN NM_020473
Insert Size 2867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020473.2, NP_065206.2
RefSeq Size 2867 bp
RefSeq ORF 510 bp
Locus ID 5277
UniProt ID P37287
Protein Families Transmembrane
Protein Pathways Glycosylphosphatidylinositol(GPI)-anchor biosynthesis, Metabolic pathways
Gene Summary This gene encodes a protein required for synthesis of N-acetylglucosaminyl phosphatidylinositol (GlcNAc-PI), the first intermediate in the biosynthetic pathway of GPI anchor. The GPI anchor is a glycolipid found on many blood cells and which serves to anchor proteins to the cell surface. Paroxysmal nocturnal hemoglobinuria, an acquired hematologic disorder, has been shown to result from mutations in this gene. Alternate splice variants have been characterized. A related pseudogene is located on chromosome 12. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and uses an alternate start codon, compared to variant 1. The resulting isoform (3) has a distinct and shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...