RAP2C (NM_021183) Human Untagged Clone
CAT#: SC310642
RAP2C (untagged)-Human RAP2C, member of RAS oncogene family (RAP2C)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310642 representing NM_021183.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGGGAATACAAGGTAGTGGTGTTAGGGAGTGGAGGGGTTGGCAAATCTGCCCTTACTGTGCAGTTT GTCACTGGGACTTTCATTGAGAAATATGACCCCACCATTGAAGATTTCTACCGCAAAGAGATCGAAGTG GACTCTTCCCCCTCCGTGCTGGAAATTCTGGACACCGCAGGAACTGAGCAGTTTGCCTCCATGAGAGAT CTCTACATCAAAAACGGCCAAGGTTTCATCCTGGTTTATAGCCTGGTTAATCAACAGTCTTTTCAGGAT ATCAAGCCAATGAGAGATCAAATTGTCAGAGTGAAGAGATATGAAAAAGTCCCACTAATCCTAGTAGGA AATAAAGTGGATCTGGAACCAGAAAGAGAGGTTATGTCTTCAGAAGGCAGAGCTCTGGCTCAAGAATGG GGCTGTCCTTTCATGGAGACATCGGCAAAAAGTAAATCAATGGTGGATGAACTTTTTGCTGAGATCGTC AGGCAAATGAACTATTCATCCCTGCCGGAGAAGCAAGATCAGTGTTGTACAACTTGTGTCGTCCAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_021183 |
Insert Size | 552 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021183.4 |
RefSeq Size | 3934 bp |
RefSeq ORF | 552 bp |
Locus ID | 57826 |
UniProt ID | Q9Y3L5 |
Domains | ras, RAS, RHO, RAB |
Protein Families | Druggable Genome |
MW | 20.7 kDa |
Gene Summary | The protein encoded by this gene is a member of the Ras-related protein subfamily of the Ras GTPase superfamily. Members of this family are small GTPases that act as molecular switches to regulate cellular proliferation, differentiation, and apoptosis. This protein has been reported to activate in vitro transcriptional activity of the serum response element. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201520 | RAP2C (Myc-DDK-tagged)-Human RAP2C, member of RAS oncogene family (RAP2C) |
CNY 2,400.00 |
|
RC201520L3 | Lenti ORF clone of Human RAP2C, member of RAS oncogene family (RAP2C), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201520L4 | Lenti ORF clone of Human RAP2C, member of RAS oncogene family (RAP2C), mGFP tagged |
CNY 5,890.00 |
|
RG201520 | RAP2C (tGFP-tagged) - Human RAP2C, member of RAS oncogene family (RAP2C) |
CNY 4,000.00 |