Parathyroid hormone related protein (PTHLH) (NM_198966) Human Untagged Clone

CAT#: SC307833

PTHLH (untagged)-Human parathyroid hormone-like hormone (PTHLH), transcript variant 4



  "NM_198966" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PTHLH Antibody
    • 100 ug

CNY 4,381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BDE2; HHM; PLP; PTHR; PTHRP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_002820, the custom clone sequence may differ by one or more nucleotides


ATGCAGCGGAGACTGGTTCAGCAGTGGAGCGTCGCGGTGTTCCTGCTGAGCTACGCGGTGCCCTCCTGCG
GGCGCTCGGTGGAGGGTCTCAGCCGCCGCCTCAAAAGAGCTGTGTCTGAACATCAGCTCCTCCATGACAA
GGGGAAGTCCATCCAAGATTTACGGCGACGATTCTTCCTTCACCATCTGATCGCAGAAATCCACACAGCT
GAAATCAGAGCTACCTCGGAGGTGTCCCCTAACTCCAAGCCCTCTCCCAACACAAAGAACCACCCCGTCC
GATTTGGGTCTGATGATGAGGGCAGATACCTAACTCAGGAAACTAACAAGGTGGAGACGTACAAAGAGCA
GCCGCTCAAGACACCTGGGAAGAAAAAGAAAGGCAAGCCCGGGAAACGCAAGGAGCAGGAAAAGAAAAAA
CGGCGAACTCGCTCTGCCTGGTTAGACTCTGGAGTGACTGGGAGTGGGCTAGAAGGGGACCACCTGTCTG
ACACCTCCACAACGTCGCTGGAGCTCGATTCACGGTAA


Restriction Sites Please inquire     
ACCN NM_198966
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198966.1, NP_945317.1
RefSeq Size 1312 bp
RefSeq ORF 534 bp
Locus ID 5744
UniProt ID P12272
Protein Families Druggable Genome, Secreted Protein
Gene Summary The protein encoded by this gene is a member of the parathyroid hormone family. This hormone, via its receptor, PTHR1, regulates endochondral bone development and epithelial-mesenchymal interactions during the formation of the mammary glands and teeth. It is responsible for most cases of humoral hypercalcemia of malignancy, and mutations in this gene are associated with brachydactyly type E2 (BDE2). Alternatively spliced transcript variants have been found for this gene. There is also evidence for alternative translation initiation from non-AUG (CUG and GUG) start sites, downstream of the initiator AUG codon, resulting in nuclear forms of this hormone. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Both variants 1 and 4 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

其它Parathyroid hormone related protein产品

Customer Reviews 
Loading...