IL28 Receptor alpha (IFNLR1) (NM_173065) Human Untagged Clone

CAT#: SC306781

IFNLR1 (untagged)-Human interleukin 28 receptor, alpha (interferon, lambda receptor) (IL28RA), transcript variant 3



  "NM_173065" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


IFNLR1 mouse monoclonal antibody,clone OTI8G1
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRF2/12; IFNLR; IL-28R1; IL28RA; LICR2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_173065, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGGCCCGAGCGCTGGGGCCCCCTGCTCCTGTGCCTGCTGCAGGCCGCTCCAGGG
AGGCCCCGTCTGGCCCCTCCCCAGAATGTGACGCTGCTCTCCCAGAACTTCAGCGTGTAC
CTGACATGGCTCCCAGGGCTTGGCAACCCCCAGGATGTGACCTATTTTGTGGCCTATCAG
AGCTCTCCCACCCGTAGACGGTGGCGCGAAGTGGAAGAGTGTGCGGGAACCAAGGAGCTG
CTATGTTCTATGATGTGCCTGAAGAAACAGGACCTGTACAACAAGTTCAAGGGACGCGTG
CGGACGGTTTCTCCCAGCTCCAAGTCCCCCTGGGTGGAGTCCGAATACCTGGATTACCTT
TTTGAAGTGGAGCCGGCCCCACCTGTCCTGGTGCTCACCCAGACGGAGGAGATCCTGAGT
GCCAATGCCACGTACCAGCTGCCCCCCTGCATGCCCCCACTGGATCTGAAGTATGAGGTG
GCATTCTGGAAGGAGGGGGCCGGAAACAAGACCCTATTTCCAGTCACTCCCCATGGCCAG
CCAGTCCAGATCACTCTCCAGCCAGCTGCCAGCGAACACCACTGCCTCAGTGCCAGAACC
ATCTACACGTTCAGTGTCCCGAAATACAGCAAGTTCTCTAAGCCCACCTGCTTCTTGCTG
GAGGTCCCAGGACTTTTCTGGACACACACACCCTGTGGCAACCTTTCAGCCCAGCAGACC
AGAGTCCGTGAATGA
Restriction Sites Please inquire     
ACCN NM_173065
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_173065.1, NP_775088.1
RefSeq Size 4418 bp
RefSeq ORF 735 bp
Locus ID 163702
UniProt ID Q8IU57
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Gene Summary The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks one alternate segment and contains another in the 3' coding region which leads to a translation frameshift, as compared to variant 1. The resulting isoform (3) has a distinct and shorter C-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...