p53 AIP1 (TP53AIP1) (NM_022112) Human Untagged Clone
CAT#: SC304994
TP53AIP1 (untagged)-Human tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 1
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | P53AIP1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_022112, the custom clone sequence may differ by one or more nucleotides
ATGGGATCTTCCTCTGAGGCGAGCTTCAGATCTGCTCAAGCTTCCTGCAGTGGGGCCAGG AGGCAGGGCCTGGGCAGGGGAGACCAGAACCTCTCGGTGATGCCTCCGAATGGCAGGGCT CAGACACACACACCTGGCTGGGTAAGTCCCTGCAGTGAAAACCGAGACGGTCTTTTGCCT GCCACAGCCCCGGGCAGACTCTGCTCTCACCGTGGTGCCGACATCCCAAGTTTTCAGACT CACCAGGACCCAGTGACAGCATCTGGGTCCTCAGAGCTGCATGCGGACTGTCCCCAGTTC AGAGCATTGGACAGAGCTGGGAACTGA |
Restriction Sites | Please inquire |
ACCN | NM_022112 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022112.1, NP_071395.1 |
RefSeq Size | 2659 bp |
RefSeq ORF | 1278 bp |
Locus ID | 63970 |
UniProt ID | Q9HCN2 |
Protein Families | Druggable Genome |
Protein Pathways | p53 signaling pathway |
Gene Summary | This gene is specifically expressed in the thymus, and encodes a protein that is localized to the mitochondrion. The expression of this gene is inducible by p53, and it is thought to play an important role in mediating p53-dependent apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (1, also known as alpha) represents the longest transcript and encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210110 | TP53AIP1 (Myc-DDK-tagged)-Human tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 1 |
CNY 1,200.00 |
|
RC210110L3 | Lenti-ORF clone of TP53AIP1 (Myc-DDK-tagged)-Human tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 1 |
CNY 5,890.00 |
|
RC210110L4 | Lenti-ORF clone of TP53AIP1 (mGFP-tagged)-Human tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 1 |
CNY 5,890.00 |
|
RG210110 | TP53AIP1 (tGFP-tagged) - Human tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 1 |
CNY 4,370.00 |
其它TP53AIP1产品