Fxyd1 (NM_194321) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	0610012C17Rik; 1110006M24Rik; P; Plm; Pml
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC225590 representing NM_194321 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCATCTCCCGGCCACATCCTGGCTCTGTGTGTGTGTCTCCTCTCCATGGCCAGTGCAGAAGCTCCAC AGGAACCGGATCCATTCACCTACGATTACCACACCCTGCGGATCGGCGGCCTCACTATCGCTGGGATCCT CTTCATCTTGGGCATCCTTATCATCCTTAGCAAGAGATGTCGATGCAAATTCAACCAACAGCAGAGAACT GGGGAACCCGACGAAGAGGAGGGAACTTTCCGCAGCTCCATCCGCCGTCTGTCATCCCGCAGGCGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_194321
Insert Size	279 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_194321.2, NP_919302.1
RefSeq Size	631 bp
RefSeq ORF	279 bp
Locus ID	56188
UniProt ID	Q9Z239
Gene Summary	This gene encodes a member of the FXYD family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The protein encoded by this gene is a plasma membrane substrate for several kinases, including protein kinase A, protein kinase C, NIMA kinase, and myotonic dystrophy kinase. It is thought to form an ion channel or regulate ion channel activity and act as an accessory protein of Na,K-ATPase. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Variants 3, 4 and 5 encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.