United States
Germany
Japan
United Kingdom
China
Wtap (NM_001113532) Mouse Untagged Clone
CAT＃: MC210211
Wtap (untagged) - Mouse Wilms' tumour 1-associating protein (Wtap), transcript variant 3, (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2810408K05Rik; 9430038B09Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210211 representing NM_001113532
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCAACGAAGAACCTCTTCCTAAAAAGGTCCGACTGAGTGAAACAGACTTCAAAGTTATGGCACGGG ATGAGTTAATTCTAAGATGGAAACAATATGAAGCATATGTTCAAGCTTTGGAGGGAAAGTACACAGATCT TAATTCAAACGATGTGACTGGTTTAAGGGAATCTGAAGAAAAACTAAAGCAGCAACAGCAGGAGTCTGCA CGCAGGGAGAACATTCTTGTCATGCGGCTAGCAACCAAAGAGCAGGAGATGCAAGAGTGCACCACTCAAA TCCAGTACCTCAAGCAAGTTCAGCAGCCGAGTGTGGCCCAACTGAGATCAACAATGGTAGACCCAGCAAT CAACTTGTTTTTCCTAAAAATGAAAGGTGAACTGGAACAGACTAAAGACAAACTGGAACAAGCCCAAAAT GAACTGAGTGCCTGGAAGTTTACGCCTGATAGGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001113532 |
| Insert Size | 456 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001113532.1, NP_001107004.1 |
| RefSeq Size | 4919 bp |
| RefSeq ORF | 456 bp |
| Locus ID | 60532 |
| UniProt ID | Q9ER69 |
| Gene Summary | Associated component of the WMM complex, a complex that mediates N6-methyladenosine (m6A) methylation of RNAs, a modification that plays a role in the efficiency of mRNA splicing and RNA processing (PubMed:29535189, PubMed:29547716). Acts as a key regulator of m6A methylation by promoting m6A methylation of mRNAs at the 3' UTR (PubMed:29547716). Required for accumulation of METTL3 and METTL14 to nuclear speckle (By similarity). Acts as a mRNA splicing regulator (By similarity). Regulates G2/M cell-cycle transition by binding to the 3' UTR of CCNA2, which enhances its stability (By similarity). Impairs WT1 DNA-binding ability and inhibits expression of WT1 target genes (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks two exons and its transcription extends past a splice site that is used in variant 1, resulting in an immediate translation termination and a different 3' UTR, compared to variant 1. It encodes isoform b which is C-terminal truncated, compared to isoform a. Variants 2 and 3 encode the same isoform b. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG218322 | Wtap (tGFP-tagged) - Mouse Wilms' tumour 1-associating protein (Wtap) transcript variant 3, (10ug) |
CNY 2,850.00 |
|
| MR218322 | Wtap (Myc-DDK-tagged) - Mouse Wilms' tumour 1-associating protein (Wtap), transcript variant 3 |
CNY 1,200.00 |
|
| MR218322L3 | Lenti ORF clone of Wtap (Myc-DDK-tagged) - Mouse Wilms' tumour 1-associating protein (Wtap), transcript variant 3 |
CNY 4,750.00 |
|
| MR218322L4 | Lenti ORF clone of Wtap (mGFP-tagged) - Mouse Wilms' tumour 1-associating protein (Wtap), transcript variant 3 |
CNY 4,750.00 |
