Cope (NM_021538) Mouse Untagged Clone
CAT#: MC203696
Cope (untagged) - Mouse coatomer protein complex, subunit epsilon (Cope), (10ug)
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110005D17Rik; Cope1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC009170
CAGAAGAAGGTTTGTTAGAGGTGCGGTGACATGGCTCCTCCGGTTCCTGGCGCGGTCTCTGGCGGCTCCG GAGAGGTAGATGAGCTGTTCGACGTGAAGAACGCTTTCTACATCGGCAGCTACCAGCAGTGCATCAACGA GGCTCAGCGCGTGAAGCTCTCCAGTCCTGAGCGGGAAGTAGAGAGGGATGTCTTCCTATACAGAGCATAC CTCGCACAGAGGAAGTATGGCGTGGTCCTGGATGAGATCAAACCCTCCTCGGCCCCAGAACTCCAGGCTG TGCGCATGTTTGCTGAGTACCTTGCCAGTGAGAACCAGAGGGACAGCATCGTGCTGGAGCTGGATCGGGA GATGAGCAGGAGTGTGGATGTGACCAATACCACTTTCCTGCTCATGGCTGCCTCCATCTACTTCCACGAC CAGAACCCGGATGCAGCCCTGCGAACCCTGCACCAGGGTGACGGCCTTGAGTGCATGGCCATGACGATTC AGATCCTCCTCAAGCTGGACAGGCTGGACCTAGCCCGGAAGGAGCTGAAGAAGATGCAGGACCAAGATGA GGACGCCACCCTTACCCAGCTAGCCACTGCCTGGGTCAACCTGGCTGTGGGTGGTGAGAAGCTACAAGAA GCCTACTACATATTCCAAGAGCTGGCCGACAAGTGCTCCCCCACACTGCTGCTGCTCAATGGCCAGGCAG CCTGCCACTCGGCACAGGGCCGCTGGGAGACTGCAGAGGGTGTGCTGCAAGAGGCACTGGACAAGGACAG CGGCCACCCTGAGACCCTCATCAATCTCATTGTACTGTCACAGCACCTGGGCAAGCCCCCTGAGGTGACA AACCGATACTTGTCACAGCTGAAGGATGCACACAGGGCCCACCCCTTCATCAAGGAGTACCAGGCCAAGG AGAACGATTTCGATCGCCTGGCAATGCAGTATGCGCCCAGTGCTTAAAGTGGAGATGCCCTGGTGACCCC AACTGTGTGCCGCGGGATGCTGTCCTCCCTTTGTGTGTGGCAATAAAGTCTATCCATTATCAAAAAAAAA AAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_021538 |
Insert Size | 927 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC009170, AAH09170 |
RefSeq Size | 1056 bp |
RefSeq ORF | 927 bp |
Locus ID | 59042 |
UniProt ID | O89079 |
Gene Summary | The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. The coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. In mammals, the coatomer can only be recruited by membranes associated with ADP-ribosylation factors (ARFs), which are small GTP-binding proteins; the complex also influences the Golgi structural integrity, as well as the processing, activity, and endocytic recycling of LDL receptors (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204352 | Cope (tGFP-tagged) - Mouse coatomer protein complex, subunit epsilon (Cope) |
CNY 2,850.00 |
|
MR204352 | Cope (Myc-DDK-tagged) - Mouse coatomer protein complex, subunit epsilon (Cope) |
CNY 1,416.00 |
|
MR204352L3 | Lenti ORF clone of Cope (Myc-DDK-tagged) - Mouse coatomer protein complex, subunit epsilon (Cope) |
CNY 4,750.00 |
|
MR204352L4 | Lenti ORF clone of Cope (mGFP-tagged) - Mouse coatomer protein complex, subunit epsilon (Cope) |
CNY 4,750.00 |