C1qtnf5 (NM_001040632) Mouse Untagged Clone

CAT#: MC202206

C1qtnf5 (untagged) - Mouse C1q and tumor necrosis factor related protein 5 (C1qtnf5), transcript variant 2, (10ug)



  "NM_001040632" in other vectors (5)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Adie; CTR; Ctrp5; Mfrp
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC025174 sequence for NM_001040632
GGAGCCAGCAAGGAGCAACCAGAAGCTAGGAGTCAGTCAGCAAGGACAGGGGCTGCCTGCCTACAGACTA CAAGAGAGGTTCCTGGAGTCTGAGCCTCCGGGGTCACCACCATGAGGCCACTTCTTGCCCTTCTGCTTCT GGGTCTGGTGTCAGGCTCTCCTCCTCTGGACGACAACAAGATCCCCAGCCTGTGTCCCGGGCAGCCCGGC CTTCCAGGCACACCAGGTCACCATGGCAGCCAAGGCCTGCCTGGCCGTGACGGCCGTGATGGCCGCGACG GTGCACCCGGAGCCCCGGGAGAGAAAGGCGAGGGCGGGAGACCGGGACTACCTGGGCCACGTGGGGAGCC CGGGCCGCGTGGAGAGGCAGGGCCCATGGGGGCTATCGGGCCTGCGGGGGAGTGCTCGGTACCCCCACGA TCAGCCTTCAGTGCCAAGCGATCCGAGAGCCGGGTACCTCCGCCAGCCGACACACCCCTACCTTTCGACC GTGTGCTGCTAAATGAGCAGGGCCATTTCGACCCCACTACTGGCAAGTTCACCTGCCAAGTGCCTGGCGT CTACTACTTTGCTGTGCACGCCACTGTCTACCGGGCCAGCTTGCAGTTTGATCTTGTCAAAAACGGGCAG TCCATCGCCTCTTTCTTCCAGTATTTTGGGGGGTGGCCCAAGCCAGCCTCGCTCTCAGGGGGTGCGATGG TAAGGCTAGAACCTGAGGACCAGGTGTGGGTGCAGGTGGGCGTGGGTGATTACATTGGCATCTATGCCAG CATCAAGACAGACAGTACCTTCTCTGGATTTCTCGTCTATTCTGACTGGCACAGCTCCCCAGTCTTCGCT TAAAACACAGTGAACCCGGAGCTGGCACTTGCTCCTCAGTGGAGGGTGTGACACTAACCCGCGCAGCGCA TACCAGGAGGGCTGGCCCCCTGGAATATTGTGAATGACTTAGGAAGAGAGGGAGCCACTTCCGGTCCCAC TGCTGGCAATGAATGGAGACAGGCTGTCTGAGGTCAAGACAGCGTGGAGCAGTGGCTGGGTTTCTGCCCA GGACTTTAGAATGCAGTAGGCTGGCAGCTGTGGGTCCTGGCCCAGGACTCCAAGGTGGGATGCTCCATTC CTAGTCCTGTGCCCCCTCTAGGTCCCTGACTCCATCTCTGCTGCTCCCAGGGCAGGCCTTTTTCTCAGAG GTCACTTAATAAACCTAAAATCCTCAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_001040632
Insert Size 732 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC025174, AAH25174
RefSeq Size 1234 bp
RefSeq ORF 732 bp
Locus ID 235312
UniProt ID Q8K479
Gene Summary The protein encoded by this gene is a member of the C1q/tumor necrosis factor superfamily. This family member is a secretory protein that functions in eye development. Mutations in this gene are thought to underlie the pathophysiology of late-onset retinal degeneration (L-ORD) and early-onset long anterior zonules (LAZ). Bicistronic transcripts composed of the coding sequences for this gene (C1qtnf5) and the membrane-type frizzled-related protein gene (Mfrp) have been identified, and the resulting products can interact with each other. Co-transcription of C1qtnf5 and Mfrp has been observed in both human and mouse. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. This variant is represented as monocistronic and may not be 5'-complete; it is unclear if it exists in bicistronic form with the Mfrp ORF, or if it is derived from an internal promoter. Variants 1-5 encode the same C1qtnf5 protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...