AKR1B1 (NM_001628) Human 3' UTR Clone

CAT#: SC205264

3' UTR clone of aldo-keto reductase family 1 member B1 (aldose reductase) (AKR1B1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AKR1B1 (NM_001628) Human 3' UTR Clone
Vector pMirTarget
Synonyms ADR; ALDR1; ALR2; AR
ACCN NM_001628
Insert Size 402 bp
Sequence Data
>SC205264 3’UTR clone of NM_001628
The sequence shown below is from the reference sequence of NM_001628. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGATTACCCCTTCCATGAAGAGTTTTGAAGCTGTGGTTGCCTGCTCGTCCCCAAGTGACCTATACCT
GTGTTTCTTGCCTCATTTTTTTCCTTGCAAATGTAGTATGGCCTGTGTCACTCAGCAGTGGGACAGCAA
CCTGTAGAGTGGCCAGCGAGGGCGTGTCTAGCTTGATGTTGGATCTCAAGAGCCCTGTCAGTAGAGTAG
AAGTCTCTTCCAGTTTGCTTTGCCCTTCTTTCTACCCTGCTGGGGAAAGTACAACCTGAATACCCTTTT
CTGACCAAAGAGAAGCAAAATCTACCAGGTCAAAATAGTGCCACTAACGGTTGAGTTTTGACTGCTTGG
AACTGGAATCCTTTCAGCAAGACTTCTCTTTGCCTCAAATAAAAAGTGCTTTTGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001628.4
Synonyms ADR; ALDR1; ALR2; AR
Summary This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
Locus ID 231
MW 14.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...