Citrate transport protein (SLC25A1) (NM_001287387) Human Untagged Clone

CAT#: SC334469

SLC25A1 (untagged) - Human solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 (SLC25A1), transcript variant 2



  "NM_001287387" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SLC25A1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMS23; CTP; D2L2AD; SEA; SLC20A3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287387, the custom clone sequence may differ by one or more nucleotides


ATGTTCGAGTTCCTCAGCAACCACATGCGGGATGCCCAGGGACGGCTGGACAGCACGCGTGGGCTGCTGT
GCGGCCTGGGCGCTGGCGTGGCCGAGGCCGTGGTGGTCGTGTGCCCCATGGAGACCATCAAGGTGAAGTT
CATCCACGACCAGACCTCCCCAAACCCCAAGTACAGAGGATTCTTCCACGGGGTTAGGGAGATTGTGCGG
GAACAAGGGCTGAAGGGGACGTACCAGGGCCTCACAGCCACTGTCCTGAAGCAGGGCTCGAACCAGGCCA
TCCGCTTCTTCGTCATGACCTCCCTGCGCAACTGGTACCGAGGGGACAACCCCAACAAGCCCATGAACCC
TCTGATCACTGGGGTCTTCGGAGCTATTGCAGGCGCAGCCAGTGTCTTTGGAAACACTCCTCTGGATGTG
ATTAAGACCCGGATGCAGGGCCTGGAGGCGCACAAATACCGGAACACGTGGGACTGCGGCTTGCAGATCC
TGAAGAAGGAGGGGCTCAAGGCATTCTACAAGGGCACTGTCCCCCGCCTGGGCCGGGTCTGCCTGGATGT
GGCCATAGTGTTTGTCATCTATGATGAAGTGGTGAAGCTGCTCAACAAAGTGTGGAAGACGGACTAA


Restriction Sites SgfI-RsrII     
ACCN NM_001287387
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287387.1, NP_001274316.1
RefSeq Size 1516 bp
RefSeq ORF 627 bp
Locus ID 6576
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the mitochondrial carrier subfamily of solute carrier proteins. Members of this family include nuclear-encoded transporters that translocate small metabolites across the mitochondrial membrane. This protein regulates the movement of citrate across the inner membranes of the mitochondria. Mutations in this gene have been associated with combined D-2- and L-2-hydroxyglutaric aciduria. Pseudogenes of this gene have been identified on chromosomes 7, 11, 16, and 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. This encodes isoform c, which has a shorter N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...