EAAT4 (SLC1A6) (NM_001272087) Human Untagged Clone

CAT#: SC333207

SLC1A6 (untagged) - Homo sapiens solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 (SLC1A6), transcript variant 1



  "NM_001272087" in other vectors (2)

CNY 2,640.00

CNY 3,040.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-SLC1A6 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EAAT4
Vector pCMV6-Entry
Sequence Data
>SC333207 representing NM_001272087.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCAGCCATGGCAACAGCCTGTTCCTGCGGGAGAGCGGCCAGCGGCTGGGCCGGGTGGGCTGGCTG
CAGCGGCTGCAGGAAAGCCTGCAGCAGAGAGCACTGCGCACGCGCCTGCGCCTGCAGACCATGACCCTC
GAGCACGTGCTGCGCTTCCTGCGCCGAAACGCCTTCATTCTGCTGACGGTCAGCGCCGTGGTCATTGGG
GTCAGCCTGGCCTTTGCCCTGCGCCCATATCAGCTCACCTACCGCCAGATCAAGTACTTCTCTTTTCCT
GGAGAGCTTCTGATGAGGATGCTGCAGATGCTGGTGTTACCTCTCATTGTCTCCAGCCTGGTCACAGGT
ATGGCATCCCTGGACAACAAGGCCACGGGGCGGATGGGGATGCGGGCAGCTGTGTACTACATGGTGACC
ACCATCATCGCGGTCTTCATCGGCATCCTCATGGTCACCATCATCCATCCCGGGAAGGGCTCCAAGGAG
GGGCTGCACCGGGAGGGCCGGATCGAGACCATCCCCACAGCTGATGCCTTCATGGACCTGATCAGAAAT
ATGTTTCCACCAAACCTTGTGGAGGCCTGCTTCAAACAGTTCAAGACGCAGTACAGCACGAGGGTGGTA
ACCAGGACCATGGTGAGGACAGAGAACGGGTCTGAGCCGGGTGCCTCCATGCCTCCTCCATTCTCAGTG
GAGAACGGAACCAGCTTCCTGGAAAATGTCACTCGGGCCTTGGGTACCCTGCAGGAGATGCTGAGCTTT
GAGGAGACTGTACCCGTGCCTGGCTCCGCCAATGGCATCAACGCCCTGGGCCTCGTGGTCTTCTCTGTG
GCCTTTGGGCTGGTCATTGGTGGCATGAAACACAAGGGCAGAGTCCTCAGGGACTTCTTCGACAGCCTC
AATGAGGCTATTATGAGGCTGGTGGGCATCATTATCTGGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001272087
Insert Size 939 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001272087.1
RefSeq Size 3039 bp
RefSeq ORF 939 bp
Locus ID 6511
UniProt ID P48664
Protein Families Transmembrane
MW 34.8 kDa
Gene Summary Sodium-dependent, high-affinity amino acid transporter that mediates the uptake of L-glutamate and also L-aspartate and D-aspartate (PubMed:7791878). Functions as a symporter that transports one amino acid molecule together with two or three Na(+) ions and one proton, in parallel with the counter-transport of one K(+) ion. Mediates Cl(-) flux that is not coupled to amino acid transport; this avoids the accumulation of negative charges due to aspartate and Na(+) symport (By similarity). Plays a redundant role in the rapid removal of released glutamate from the synaptic cleft, which is essential for terminating the postsynaptic action of glutamate (Probable).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...