REG4 (NM_001159352) Human Untagged Clone
CAT#: SC327377
REG4 (untagged)-Human regenerating islet-derived family member 4 (REG4) transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GISP; REG-IV; RELP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327377 representing NM_001159352.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTTCCAGAAGCATGCGGCTGCTCCTATTGCTGAGCTGCCTGGCCAAAACAGGAGTCCTGGGTGAT ATCATCATGAGACCCAGCTGTGCTCCTGGATGGTTTTACCACAAGTCCAATTGCTATGGTTACTTCAGG AAGCTGAGGAACTGGTCTGATGCCGAGCTCGAGTGTCAGTCTTACGGAAACGGAGCCCACCTGGCATCT ATCCTGAGTTTAAAGGAAGCCAGCACCATAGCAGAGTACATAAGTGGCTATCAGAGAAGCCAGCCGATA TGGATTGGCCTGCACGACCCACAGAAGAGGCAGCAGTGGCAGTGGATTGATGGGGCCATGTATCTGTAC AGATCCTGGTCTGGCAAGTCCATGGGTGGGAACAAGCACTGTGCTGAGATGAGCTCCAATAACAACTTT TTAACTTGGAGCAGCAACGAATGCAACAAGCGCCAACACTTCCTGTGCAAGTACCGACCATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001159352 |
Insert Size | 477 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001159352.1 |
RefSeq Size | 1517 bp |
RefSeq ORF | 477 bp |
Locus ID | 83998 |
UniProt ID | Q9BYZ8 |
Protein Families | Secreted Protein |
MW | 18.2 kDa |
Gene Summary | Calcium-independent lectin displaying mannose-binding specificity and able to maintain carbohydrate recognition activity in an acidic environment. May be involved in inflammatory and metaplastic responses of the gastrointestinal epithelium.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) is the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228742 | REG4 (Myc-DDK-tagged)-Human regenerating islet-derived family, member 4 (REG4), transcript variant 1 |
CNY 1,200.00 |
|
RC228742L1 | Lenti ORF clone of Human regenerating islet-derived family, member 4 (REG4), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC228742L2 | Lenti ORF clone of Human regenerating islet-derived family, member 4 (REG4), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC228742L3 | Lenti ORF clone of Human regenerating islet-derived family, member 4 (REG4), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228742L4 | Lenti ORF clone of Human regenerating islet-derived family, member 4 (REG4), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG228742 | REG4 (tGFP-tagged) - Human regenerating islet-derived family, member 4 (REG4), transcript variant 1 |
CNY 4,370.00 |