United States
Germany
Japan
United Kingdom
China
TXK (NM_003328) Human Untagged Clone
CAT＃: SC323664
TXK (untagged)-Kinase deficient mutant (K299M) of Human TXK tyrosine kinase (TXK)
CNY 5,896.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BTKL; PSCTK5; PTK4; RLK; TKL |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_003328, the custom clone sequence may differ by one or more nucleotides
ATGATCCTTTCCTCCTATAACACCATCCAGTCGGTTTTCTGTTGCTGCTGTTGCTGTTCAGTGCAGAAGC GACAAATGAGAACACAGATAAGCCTGAGCACAGATGAAGAGCTTCCAGAAAAATACACCCAGCGTCGCAG GCCGTGGCTCAGCCAATTGTCAAATAAGAAGCAATCCAACACGGGCCGTGTGCAGCCGTCAAAACGAAAG CCACTGCCTCCCCTCCCACCCTCTGAGGTTGCTGAAGAGAAGATCCAAGTCAAGGCACTTTATGATTTTC TGCCCAGAGAACCCTGTAATTTAGCCTTAAGGAGAGCAGAAGAATACCTGATACTGGAGAAATACAATCC TCACTGGTGGAAGGCAAGAGACCGTTTGGGGAATGAAGGCTTAATCCCAAGCAACTATGTGACTGAAAAC AAAATAACTAATTTAGAAATATATGAGTGGTACCATAGAAACATTACCAGAAATCAGGCAGAACATCTAT TGAGACAAGAGTCTAAAGAAGGTGCATTTATTGTCAGAGATTCAAGACATTTAGGATCCTACACAATTTC CGTATTTATGGGAGCTAGAAGAAGTACGGAGGCTGCCATAAAACATTATCAGATAAAAAAGAATGACTCA GGACAGTGGTATGTGGCTGAAAGACACGCCTTTCAATCAATCCCTGAGTTAATCTGGTATCACCAGCACA ATGCAGCCGGTCTCATGACTCGTCTCCGATATCCAGTTGGGCTGATGGGCAGTTGTTTACCAGCCACAGC TGGGTTTAGCTACGAAAAGTGGGAGATAGATCCATCTGAGTTGGCTTTTATAAAGGAGATTGGAAGCGGT CAGTTTGGAGTGGTCCATTTAGGTGAATGGCGGTCACATATCCAGGTAGCTATCAAGGCCATCAATGAAG GCTCCATGTCTGAAGAGGATTTCATTGAAGAGGCCAAAGTGATGATGAAATTATCTCATTCAAAGCTAGT GCAACTTTATGGAGTCTGTATACAGCGGAAGCCCCTTTACATTGTGACAGAGTTCATGGAAAATGGCTGC CTGCTTAACTATCTCAGGGAGAATAAAGGAAAGCTTAGGAAGGAAATGCTACTGAGTGTATGCCAGGATA TATGTGAAGGAATGGAATATCTGGAGAGGAATGGCTATATTCATAGGGATTTGGCGGCAAGGAATTGTTT GGTCAGTTCAACATGCATAGTAAAAATTTCAGACTTTGGAATGACAAGGTACGTTTTGGATGATGAGTAT GTCAGTTCTTTTGGAGCCAAGTTCCCAATCAAGTGGTCCCCTCCTGAAGTTTTTCTTTTCAATAAGTACA GCAGTAAATCTGATGTCTGGTCATTTGGAGTTTTAATGTGGGAAGTTTTTACAGAAGGAAAAATGCCTTT TGAAAATAAGTCAAATTTGCAAGTCGTGGAAGCTATTTCTGAAGGCTTCAGGCTATATCGCCCTCACCTG GCACCAATGTCCATATATGAAGTCATGTACAGCTGCTGGCATGAGAAACCTGAAGGCCGCCCTACATTTG CCGAGCTGCTGCGGGCTGTCACAGAGATTGCGGAAACCTGGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_003328 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_003328.1, NP_003319.1 |
| RefSeq Size | 2564 bp |
| RefSeq ORF | 1584 bp |
| Locus ID | 7294 |
| UniProt ID | P42681 |
| Domains | pkinase, SH2, SH3 |
| Protein Families | Druggable Genome, Protein Kinase |
| Protein Pathways | Leukocyte transendothelial migration |
| Gene Summary | Non-receptor tyrosine kinase that plays a redundant role with ITK in regulation of the adaptive immune response. Regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. When antigen presenting cells (APC) activate T-cell receptor (TCR), a series of phosphorylation lead to the recruitment of TXK to the cell membrane, where it is phosphorylated at Tyr-420. Phosphorylation leads to TXK full activation. Contributes also to signaling from many receptors and participates in multiple downstream pathways, including regulation of the actin cytoskeleton. Like ITK, can phosphorylate PLCG1, leading to its localization in lipid rafts and activation, followed by subsequent cleavage of its substrates. In turn, the endoplasmic reticulum releases calcium in the cytoplasm and the nuclear activator of activated T-cells (NFAT) translocates into the nucleus to perform its transcriptional duty. With PARP1 and EEF1A1, TXK forms a complex that acts as a T-helper 1 (Th1) cell-specific transcription factor and binds the promoter of IFNG to directly regulate its transcription, and is thus involved importantly in Th1 cytokine production. Phosphorylates both PARP1 and EEF1A1. Phosphorylates also key sites in LCP2 leading to the up-regulation of Th1 preferred cytokine IL-2. Phosphorylates 'Tyr-201' of CTLA4 which leads to the association of PI-3 kinase with the CTLA4 receptor.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213356 | TXK (Myc-DDK-tagged)-Human TXK tyrosine kinase (TXK) |
CNY 5,888.00 |
|
| RC213356L3 | Lenti-ORF clone of TXK (Myc-DDK-tagged)-Human TXK tyrosine kinase (TXK) |
CNY 6,460.00 |
|
| RC213356L4 | Lenti-ORF clone of TXK (mGFP-tagged)-Human TXK tyrosine kinase (TXK) |
CNY 6,460.00 |
|
| RG213356 | TXK (tGFP-tagged) - Human TXK tyrosine kinase (TXK) |
CNY 7,488.00 |
|
| SC128174 | TXK (untagged)-Human TXK tyrosine kinase (TXK) |
CNY 5,896.00 |
