RFC3 (NM_181558) Human Untagged Clone
CAT#: SC317454
RFC3 (untagged)-Human replication factor C (activator 1) 3, 38kDa (RFC3), transcript variant 2
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RFC38 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317454 representing NM_181558.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCCTCTGGGTGGACAAGTATCGGCCCTGCTCCTTGGGACGGCTGGACTATCACAAGGAGCAGGCG GCCCAGCTGCGGAACCTGGTGCAGTGTGGTGACTTTCCTCATCTGTTAGTGTACGGACCATCAGGTGCT GGAAAAAAGACAAGAATTATGTGTATTCTACGTGAACTTTATGGTGTTGGAGTGGAAAAATTGAGAATT GAACATCAGACCATCACAACTCCATCTAAAAAAAAAATTGAAATTAGCACCATTGCAAGTAACTACCAC CTTGAAGTTAATCCTAGTGATGCTGGAAATAGTGACCGAGTAGTCATTCAGGAGATGTTGAAAACAGTG GCACAATCACAACAACTTGAAACAAACTCTCAAAGGGATTTTAAAGTGGTATTATTGACAGAAGTTGAC AAACTCACCAAAGATGCTCAGCATGCCTTGCGAAGAACCATGGAAAAATATATGTCTACCTGCAGATTG ATCTTGTGCTGCAATTCTACATCTAAAGTGATCCCACCTATTCGTAGTAGGTGCTTGGCGGTTCGTGTG CCTGCTCCCAGCATTGAAGATATTTGCCACGTGTTATCTACTGTGTGTAAGAAGGAAGGTCTGAATCTT CCTTCACAACTGGCTCATAGACTTGCAGAGAAGTCTTGTAGAAATCTCAGAAAAGCCCTGCTTATGTGT GAAGCCTGCAGAGTGCAACAATATCCTTTTACTGCAGATCAAGAAATCCCTGAGACAGATTGGGAGGTG TATCTGAGGGAGACTGCAAATGCTATTGTCAGTCAGCAAACTCCACAAAGGCTCCTTGAAGTTCGTGGA AGGCTGTATGAGCTTCTAACTCATTGTATTCCTCCTGAGATAATAATGAAGGCATGTAAGGAGGAATCA AGAAGCTGTGACATATTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_181558 |
Insert Size | 918 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_181558.2 |
RefSeq Size | 1463 bp |
RefSeq ORF | 918 bp |
Locus ID | 5983 |
UniProt ID | P40938 |
Protein Families | Stem cell - Pluripotency |
Protein Pathways | DNA replication, Mismatch repair, Nucleotide excision repair |
MW | 34.8 kDa |
Gene Summary | The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kDa. This gene encodes the 38 kDa subunit. This subunit is essential for the interaction between the 140 kDa subunit and the core complex that consists of the 36, 37, and 40 kDa subunits. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214617 | RFC3 (Myc-DDK-tagged)-Human replication factor C (activator 1) 3, 38kDa (RFC3), transcript variant 2 |
CNY 2,400.00 |
|
RC214617L3 | Lenti ORF clone of Human replication factor C (activator 1) 3, 38kDa (RFC3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214617L4 | Lenti ORF clone of Human replication factor C (activator 1) 3, 38kDa (RFC3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG214617 | RFC3 (tGFP-tagged) - Human replication factor C (activator 1) 3, 38kDa (RFC3), transcript variant 2 |
CNY 4,370.00 |
|
SC107306 | RFC3 (untagged)-Human replication factor C (activator 1) 3, 38kDa (RFC3), transcript variant 2 |
CNY 2,400.00 |