RFC3 (NM_181558) Human Untagged Clone

CAT#: SC317454

RFC3 (untagged)-Human replication factor C (activator 1) 3, 38kDa (RFC3), transcript variant 2



  "NM_181558" in other vectors (5)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RFC3 mouse monoclonal antibody,clone OTI3F6
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RFC38
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317454 representing NM_181558.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCCTCTGGGTGGACAAGTATCGGCCCTGCTCCTTGGGACGGCTGGACTATCACAAGGAGCAGGCG
GCCCAGCTGCGGAACCTGGTGCAGTGTGGTGACTTTCCTCATCTGTTAGTGTACGGACCATCAGGTGCT
GGAAAAAAGACAAGAATTATGTGTATTCTACGTGAACTTTATGGTGTTGGAGTGGAAAAATTGAGAATT
GAACATCAGACCATCACAACTCCATCTAAAAAAAAAATTGAAATTAGCACCATTGCAAGTAACTACCAC
CTTGAAGTTAATCCTAGTGATGCTGGAAATAGTGACCGAGTAGTCATTCAGGAGATGTTGAAAACAGTG
GCACAATCACAACAACTTGAAACAAACTCTCAAAGGGATTTTAAAGTGGTATTATTGACAGAAGTTGAC
AAACTCACCAAAGATGCTCAGCATGCCTTGCGAAGAACCATGGAAAAATATATGTCTACCTGCAGATTG
ATCTTGTGCTGCAATTCTACATCTAAAGTGATCCCACCTATTCGTAGTAGGTGCTTGGCGGTTCGTGTG
CCTGCTCCCAGCATTGAAGATATTTGCCACGTGTTATCTACTGTGTGTAAGAAGGAAGGTCTGAATCTT
CCTTCACAACTGGCTCATAGACTTGCAGAGAAGTCTTGTAGAAATCTCAGAAAAGCCCTGCTTATGTGT
GAAGCCTGCAGAGTGCAACAATATCCTTTTACTGCAGATCAAGAAATCCCTGAGACAGATTGGGAGGTG
TATCTGAGGGAGACTGCAAATGCTATTGTCAGTCAGCAAACTCCACAAAGGCTCCTTGAAGTTCGTGGA
AGGCTGTATGAGCTTCTAACTCATTGTATTCCTCCTGAGATAATAATGAAGGCATGTAAGGAGGAATCA
AGAAGCTGTGACATATTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_181558
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181558.2
RefSeq Size 1463 bp
RefSeq ORF 918 bp
Locus ID 5983
UniProt ID P40938
Protein Families Stem cell - Pluripotency
Protein Pathways DNA replication, Mismatch repair, Nucleotide excision repair
MW 34.8 kDa
Gene Summary The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kDa. This gene encodes the 38 kDa subunit. This subunit is essential for the interaction between the 140 kDa subunit and the core complex that consists of the 36, 37, and 40 kDa subunits. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...