BMF (NM_001003943) Human Untagged Clone
CAT#: SC300583
BMF (untagged)-Human Bcl2 modifying factor (BMF), transcript variant 4
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001003943, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCATCTCAGTGTGTGGAGGAGCTGGAGGATGATGTGTTCCAACCAGAGGATGGG GAGCCGGTGACCCAACCCGGGAGCTTGCTCTCTGCTGACCTGTTTGCCCAGAGCCTACTG GACTGCCCCCTCAGCCGACTTCAGCTCTTCCCTCTCACCCACTGCTGTGGCCCTGGCCTT CGACCCACCAGCCAGGAAGACAAAGCTACCCAGACTCTCAGCCCAGCCTCCCCCAGCCAA GGTGTCATGCTGCCTTGTGGGGTGACTGAGGAACCCCAGCGACTCTTTTATGCACCAGCA GAACCAAAATCGTGTGTGGTGGCAGATCCTCCTCTTCCTGCACAACCTTGCTTTGAATGG AGAAGAGAACAGGAACGGGGCAGGCCCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001003943 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001003943.1, NP_001003943.1 |
RefSeq Size | 4304 bp |
RefSeq ORF | 390 bp |
Locus ID | 90427 |
UniProt ID | Q96LC9 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an apoptotic activator. This protein is found to be sequestered to myosin V motors by its association with dynein light chain 2, which may be important for sensing intracellular damage and triggering apoptosis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) lacks an in-frame coding exon, compared to variant 1. It encodes a shorter isoform (bmf-3), compared to isoform bmf-1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223732 | BMF (Myc-DDK-tagged)-Human Bcl2 modifying factor (BMF), transcript variant 4 |
CNY 3,990.00 |
|
RC223732L3 | Lenti-ORF clone of BMF (Myc-DDK-tagged)-Human Bcl2 modifying factor (BMF), transcript variant 4 |
CNY 5,890.00 |
|
RC223732L4 | Lenti-ORF clone of BMF (mGFP-tagged)-Human Bcl2 modifying factor (BMF), transcript variant 4 |
CNY 5,890.00 |
|
RG223732 | BMF (tGFP-tagged) - Human Bcl2 modifying factor (BMF), transcript variant 4 |
CNY 4,370.00 |