Gapdh Mouse qPCR Primer Pair (NM_008084)
CNY 1,140.00
Cited in 23 publications. |
Product images
CNY 2,400.00
CNY 2,556.00
CNY 2,710.00
CNY 3,610.00
CNY 3,330.00
CNY 1,200.00
CNY 1,900.00
Specifications
Product Data | |
Gene ID | 14433 |
Forward Sequence | CATCACTGCCACCCAGAAGACTG |
Reverse Sequence | ATGCCAGTGAGCTTCCCGTTCAG |
Synonyms | Ga; Gapd |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (23)
The use of this Gene Expression has been cited in the following citations: |
---|
scRNA-sequencing reveals subtype-specific transcriptomic perturbations in DRG neurons of Pirt EGFPf mice in neuropathic pain condition
,null,
eLife
,PubMed ID 36264609
[Gapdh]
|
Reduced cleavage of von willebrand factor by ADAMTS13 is associated with microangiopathic acute kidney injury following trauma
,null,
Blood Coagulation & Fibrinolysis
,PubMed ID 34889809
[Gapdh]
|
Alleviation of Methamphetamine Sensitization by Partially Lesioning Dopaminergic Terminals with 6-Hydroxydopamine in Nucleus Accumbens
,null,
Cell Transplantation
,PubMed ID 34743572
[Gapdh]
|
Microneedle‐Based Local Delivery of CCL22 and IL‐2 Enriches T reg Homing to the Skin Allograft and Enables Temporal Monitoring of Immunotherapy Efficacy
,Puigmal, N;Dosta, P;Solhjou, Z;Yatim, K;Ramírez, C;Choi, J;Alhaddad, J;Cosme, A;Azzi, J;Artzi, N;,
Advanced Functional Materials
[GAPDH]
|
Up-Regulation of the Long Noncoding RNA X-Inactive-Specific Transcript and the Imbalance Sex/Ratio of Pulmonary Arterial Hypertension
,Qin, S;Predescu, D;Carman, B;Patel, P;Chen, J;Kim, M;Lahm, T;Geraci, M;Predescu, S;,
The American journal of pathology
,PubMed ID 33836164
[GAPDH]
|
ETS Proto-Oncogene 1 Suppresses MicroRNA-128 Transcription to Promote Osteogenic Differentiation Through the HOXA13/β-Catenin Axis
,Li, R;Dong, Y;Li, F;,
Frontiers in physiology
,PubMed ID 33746773
[GAPDH]
|
In vivo base editing rescues Hutchinson-Gilford progeria syndrome in mice
,Koblan, LW;Erdos, MR;Wilson, C;Cabral, WA;Levy, JM;Xiong, ZM;Tavarez, UL;Davison, LM;Gete, YG;Mao, X;Newby, GA;Doherty, SP;Narisu, N;Sheng, Q;Krilow, C;Lin, CY;Gordon, LB;Cao, K;Collins, FS;Brown, JD;Liu, DR;,
Nature
,PubMed ID 33408413
[GAPDH]
|
A lung-on-chip model of early Mycobacterium tuberculosis infection reveals an essential role for alveolar epithelial cells in controlling bacterial growth
,Thacker, VV;Dhar, N;Sharma, K;Barrile, R;Karalis, K;McKinney, JD;,
eLife
,PubMed ID 33228849
[GAPDH]
|
Phosphorylated STAT3 suppresses microRNA‐19b/1281 to aggravate lung injury in mice with type 2 diabetes mellitus‐associated pulmonary tuberculosis, et al. Phosphorylated STAT3 suppresses microRNA‐19b/1281 to aggravate lung injury in mice with type 2 diabetes mellitus‐associated pulmonary tuberculosis
,null,
Journal of Cellular and Molecular Medicine
,PubMed ID 33089914
[Gapdh]
|
Sensory Experience Engages Microglia to Shape Neural Connectivity through a Non-Phagocytic Mechanism
,Cheadle, L;Rivera, SA;Phelps, JS;Ennis, KA;Stevens, B;Burkly, LC;Lee, WA;Greenberg, ME;,
Neuron
,PubMed ID 32931754
[GAPDH]
|
Soluble (pro)renin receptor promotes fibrotic response in renal proximal tubule epithelial cells in vitro via Akt/β-catenin/Snail signaling pathway
,Xie, S;Su, J;Lu, A;Lai, Y;Mo, S;Pu, M;Yang, T;,
Am. J. Physiol. Renal Physiol.
,PubMed ID 32865015
[GAPDH ]
|
Impaired AKT signaling and lung tumorigenesis by PIERCE1 ablation in KRAS-mutant non-small cell lung cancer
,Roh, JI;Lee, J;Sung, YH;Oh, J;Hyeon, DY;Kim, Y;Lee, S;Devkota, S;Kim, HJ;Park, B;Nam, T;Song, Y;Kim, Y;Hwang, D;Lee, HW;,
Oncogene
,PubMed ID 32728173
[GAPDH]
|
Ceramide Synthase 5 Deficiency Aggravates Dextran Sodium Sulfate-Induced Colitis and Colon Carcinogenesis and Impairs T-Cell Activation
,El-Hindi, K;Brachtendorf, S;Hartel, JC;Oertel, S;Birod, K;Trautmann, S;Thomas, D;Ulshöfer, T;Weigert, A;Utermöhlen, O;Krönke, M;Grösch, S;,
Cancers (Basel) 2020
,PubMed ID 32630271
[GAPDH]
|
Sevoflurane attenuates cardiomyocyte apoptosis by mediating the miR-219a/AIM2/TLR4/MyD88 axis in myocardial ischemia/reperfusion injury in mice
,Li, Y;Xing, N;Yuan, J;Yang, J;,
Cell Cycle
,PubMed ID 32449438
[GAPDH]
|
Sh3rf2 Haploinsufficiency Leads to Unilateral Neuronal Development Deficits and Autistic-Like Behaviors in Mice.
,null,
Cell reports
,PubMed ID 30540932
[Gapdh]
|
Visual Experience-Dependent Expression of Fn14 Is Required for Retinogeniculate Refinement
,Cheadle, L;Tzeng, CP;Kalish, BT;Harmin, DA;Rivera, S;Ling, E;Nagy, MA;Hrvatin, S;Hu, L;Stroud, H;Burkly, LC;Chen, C;Greenberg, ME;,
Neuron
,PubMed ID 30033152
[GAPDH]
|
Type 3 innate lymphoid cell-derived lymphotoxin prevents microbiota-dependent inflammation
,null,
Cellular and Molecular Immunology
,PubMed ID 28579615
[Gapdh]
|
ETV1 activates a rapid conduction transcriptional program in rodent and human cardiomyocytes
,Shekhar, A;Lin, X;Lin, B;Liu, FY;Zhang, J;Khodadadi-Jamayran, A;Tsirigos, A;Bu, L;Fishman, GI;Park, DS;,
Sci Rep
,PubMed ID 29967479
[GAPDH]
|
In vitro and in vivo investigation of PLA/PCL scaffold coated with metformin-loaded gelatin nanocarriers in regeneration of critical-sized bone defects
,Shahrezaee, M;Salehi, M;Keshtkari, S;Oryan, A;Kamali, A;Shekarchi, B;,
Nanomedicine
,PubMed ID 29964218
[GAPDH]
|
CaMKII-mediated Beclin 1 phosphorylation regulates autophagy that promotes degradation of Id and neuroblastoma cell differentiation
,null,
Nature Communications
,PubMed ID 29079782
[Gapdh]
|
Anti-proliferative effects of ?-tocotrienol are associated with suppression of c-Myc expression in mammary tumour cells
,Parajuli, P;Tiwari, RV;Sylvester, PW;,
Cell Prolif.
,PubMed ID 26096843
[GAPDH]
|
RC/BTB2 is essential for formation of primary cilia in mammalian cells
,Zhang, L;Li, W;Ni, J;Wu, J;Liu, J;Zhang, Z;Zhang, Y;Li, H;Shi, Y;Teves, ME;Song, S;Strauss, JF;Zhang, Z;,
Cytoskeleton (Hoboken)
,PubMed ID 25762510
[Gapdh]
|
Delivery of bioactive lipids from composite microgel-microsphere injectable scaffolds enhances stem cell recruitment and skeletal repair
,Das, A;Barker, DA;Wang, T;Lau, CM;Lin, Y;Botchwey, EA;,
PLoS ONE
,PubMed ID 25077607
[Gapdh]
|
Documents
FAQs |
Resources
基因表达相关资源 |