Human TRIAD3 (RNF216) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	RNF216
Locus ID	54476
Kit Components	GA110126G1, TRIAD3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTCACCCTCCTGCCTCGTG GA110126G2, TRIAD3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACTAGGCGGCCCTCTCTA GA110126G3, TRIAD3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGAGGCACTCCGGGTACTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_019011, NM_207111, NM_207116
Synonyms	U7I1; UBCE7IP1; ZIN
Summary	This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.