Proteasome subunit beta type 2 (PSMB2) (NM_001199780) Human Untagged Clone

CAT#: SC333412

PSMB2 (untagged) - Human proteasome (prosome, macropain) subunit, beta type, 2 (PSMB2), transcript variant 3



  "NM_001199780" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PSMB2 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HC7-I
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333412 representing NM_001199780.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACTACCTGGCAGCCTTGGCCAAGGCCCCTTTTGCAGCCCACGGCTATGGTGCCTTCCTGACTCTC
AGTATCCTCGACCGATACTACACACCGACTATCTCACGTGAGAGGGCAGTGGAACTCCTTAGGAAATGT
CTGGAGGAGCTCCAGAAACGCTTCATCCTGAATCTGCCAACCTTCAGTGTTCGAATCATTGACAAAAAT
GGCATCCATGACCTGGATAACATTTCCTTCCCCAAACAGGGCTCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001199780
Insert Size 255 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199780.1
RefSeq Size 4235 bp
RefSeq ORF 255 bp
Locus ID 5690
Protein Families Druggable Genome, Protease
Protein Pathways Proteasome
MW 9.6 kDa
Gene Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) lacks two exons from the 5' end and has an alternate 5' exon, as compared to variant 1. The resulting isoform (3) is shorter at the N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...