IL6R (NM_001206866) Human Untagged Clone

CAT#: SC331697

IL6R (untagged) - Homo sapiens interleukin 6 receptor (IL6R), transcript variant 3



  "NM_001206866" in other vectors (2)

CNY 3,420.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
IL6R mouse monoclonal antibody, clone OTI2F4 (formerly 2F4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD126; gp80; HIES5; IL-1Ra; IL-6R; IL-6R-1; IL-6RA; IL6Q; IL6QTL; IL6RA; IL6RQ
Vector pCMV6-Entry
Sequence Data
>SC331697 representing NM_001206866.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGGCCGTCGGCTGCGCGCTGCTGGCTGCCCTGCTGGCCGCGCCGGGAGCGGCGCTGGCCCCAAGG
CGCTGCCCTGCGCAGGAGGTGGCGAGAGGCGTGCTGACCAGTCTGCCAGGAGACAGCGTGACTCTGACC
TGCCCGGGGGTAGAGCCGGAAGACAATGCCACTGTTCACTGGGTGCTCAGGAAGCCGGCTGCAGGCTCC
CACCCCAGCAGATGGGCTGGCATGGGAAGGAGGCTGCTGCTGAGGTCGGTGCAGCTCCACGACTCTGGA
AACTATTCATGCTACCGGGCCGGCCGCCCAGCTGGGACTGTGCACTTGCTGGTGGATGTTCCCCCCGAG
GAGCCCCAGCTCTCCTGCTTCCGGAAGAGCCCCCTCAGCAATGTTGTTTGTGAGTGGGGTCCTCGGAGC
ACCCCATCCCTGACGACAAAGGCTGTGCTCTTGGTGAGGAAGTTTCAGAACAGTCCGGCCGAAGACTTC
CAGGAGCCGTGCCAGTATTCCCAGGAGTCCCAGAAGTTCTCCTGCCAGTTAGCAGTCCCGGAGGGAGAC
AGCTCTTTCTACATAGTGTCCATGTGCGTCGCCAGTAGTGTCGGGAGCAAGTTCAGCAAAACTCAAACC
TTTCAGGGTTGTGGAATCTTGCAGCCTGATCCGCCTGCCAACATCACAGTCACTGCCGTGGCCAGAAAC
CCCCGCTGGCTCAGTGTCACCTGGCAAGACCCCCACTCCTGGAACTCATCTTTCTACAGACTACGGTTT
GAGCTCAGATATCGGGCTGAACGGTCAAAGACATTCACAACATGGATGGTCAAGGACCTCCAGCATCAC
TGTGTCATCCACGACGCCTGGAGCGGCCTGAGGCACGTGGTGCAGCTTCGTGCCCAGGAGGAGTTCGGG
CAAGGCGAGTGGAGCGAGTGGAGCCCGGAGGCCATGGGCACGCCTTGGACAGACAGGCTTTCTCCTCGT
TGCCCAGGATGGAGTACAGCAGTGCAATCACAGCTCACGGCAACTTCTGCCTCCTGGGTTCAAGCAATC
CTCCCGCCTCAGCCTCCTAAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001206866
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206866.1
RefSeq Size 2058 bp
RefSeq ORF 1059 bp
Locus ID 3570
UniProt ID P08887
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
MW 38.8 kDa
Gene Summary This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been identified in this gene. A pseudogene of this gene is found on chromosome 9. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (3) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift. The resulting protein (isoform 3) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...