IFTAP (NM_001276725) Human Untagged Clone

CAT#: SC331071

C11orf74 (untagged) - Homo sapiens chromosome 11 open reading frame 74 (C11orf74), transcript variant 5



  "NM_001276725" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-C11orf74 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C11orf74; HEPIS; NWC
Vector pCMV6-Entry
Sequence Data
>SC331071 representing NM_001276725.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTGCCCATATGTCAGGATTGGAAATAATGGATGAAGATCAATTAATCAAAGACGTCTTGGATAAA
TTCCTTAATTGTCATGAGCAAACATATGATGAAGAATTTCTGAACACTTTTACTCATCTTTCACAAGAT
TTGCTGCTGCTTCCAGGAGAAGTGGAGCAGGATGTAAGCACCAGCATTCCTTCCTGTATCCCTTTTGTG
GCCCAGCCTCCTACCTGTGAAGTGAAGCCAAAGCCCAGTGTTAAAAGAATGGACAAACAGACGGAAGAG
ATACTTGGAGATGAAGTTCAACTTTTTTCACTTGATGAAGAATTTGATTATGACAATGTGATGCTAACC
TCCAAGTTTAGTCCTGCAGAGATAGAGAACATCAAAGAGCTATGCAAGCAGCAGAAGAGAAAGGACACC
AGCCCAGACTTAGAGAAATCCTGTGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001276725
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276725.1
RefSeq Size 858 bp
RefSeq ORF 444 bp
Locus ID 119710
UniProt ID Q86VG3
MW 16.8 kDa
Gene Summary This gene encodes a protein that was identified as a cellular interacting partner of non-structural protein 10 of the severe acute respiratory syndrome coronavirus (SARS-CoV). The encoded protein may function as a negative regulator of transcription. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (5) lacks two in-frame exons, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Variants 5, 6, and 7 encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...