United States
Germany
Japan
United Kingdom
China
HMGB2 (NM_001130688) Human Untagged Clone
CAT＃: SC324790
HMGB2 (untagged)-Human high mobility group box 2 (HMGB2), transcript variant 2
CNY 3,840.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HMG2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001130688, the custom clone sequence may differ by one or more nucleotides
ATGGGTAAAGGAGACCCCAACAAGCCGCGGGGCAAAATGTCCTCGTACGCCTTCTTCGTG CAGACCTGCCGGGAAGAGCACAAGAAGAAACACCCGGACTCTTCCGTCAATTTCGCGGAA TTCTCCAAGAAGTGTTCGGAGAGATGGAAGACCATGTCTGCAAAGGAGAAGTCGAAGTTT GAAGATATGGCAAAAAGTGACAAAGCTCGCTATGACAGGGAGATGAAAAATTACGTTCCT CCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCCAATGCTCCTAAAAGGCCACCATCT GCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCAAAAGTGAACACCCTGGCCTA TCCATTGGGGATACTGCAAAGAAATTGGGTGAAATGTGGTCTGAGCAGTCAGCCAAAGAT AAACAACCATATGAACAGAAAGCAGCTAAGCTAAAGGAGAAATATGAAAAGGATATTGCT GCATATCGTGCCAAGGGCAAAAGTGAAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGC TCAAAGAAGAAGAACGAACCAGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGAT GAGGAGGAAGAGGATGAAGATGAAGAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001130688 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001130688.1, NP_001124160.1 |
| RefSeq Size | 1467 bp |
| RefSeq ORF | 630 bp |
| Locus ID | 3148 |
| UniProt ID | P26583 |
| Protein Families | Druggable Genome, Transcription Factors |
| Gene Summary | This gene encodes a member of the non-histone chromosomal high mobility group protein family. The proteins of this family are chromatin-associated and ubiquitously distributed in the nucleus of higher eukaryotic cells. In vitro studies have demonstrated that this protein is able to efficiently bend DNA and form DNA circles. These studies suggest a role in facilitating cooperative interactions between cis-acting proteins by promoting DNA flexibility. This protein was also reported to be involved in the final ligation step in DNA end-joining processes of DNA double-strand breaks repair and V(D)J recombination. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225239 | HMGB2 (Myc-DDK-tagged)-Human high mobility group box 2 (HMGB2), transcript variant 2 |
CNY 3,600.00 |
|
| RC225239L3 | Lenti ORF clone of Human high mobility group box 2 (HMGB2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225239L4 | Lenti ORF clone of Human high mobility group box 2 (HMGB2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG225239 | HMGB2 (tGFP-tagged) - Human high mobility group box 2 (HMGB2), transcript variant 2 |
CNY 4,370.00 |
