United States
Germany
Japan
United Kingdom
China
RNase H2 subunit C (RNASEH2C) (NM_032193) Human Untagged Clone
CAT＃: SC319590
RNASEH2C (untagged)-Human ribonuclease H2, subunit C (RNASEH2C)
CNY 1,200.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AGS3; AYP1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_032193.3
GCGCTTTCCGCGCCAGCTTCAGTGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGG
ATGGAGAGCGGCGACGAAGCGGCCATCGAGAGGCACCGCGTCCACTTGCGCTCCGCCACA TTGCGCGACGCCGTACCCGCCACACTGCATCTGCTGCCCTGCGAGGTTGCGGTGGACGGG CCCGCCCCGGTGGGGCGCTTCTTCACGCCCGCCATCCGCCAGGGCCCCGAGGGACTCGAA GTGTCGTTTCGGGGCCGCTGTCTACGGGGAGAGGAGGTGGCGGTGCCGCCTGGCCTCGTG GGATACGTGATGGTGACAGAAGAGAAGAAGGTGTCGATGGGGAAGCCAGACCCCTTGCGG GATTCCGGGACTGACGACCAAGAGGAGGAGCCGCTGGAGCGGGACTTCGACCGCTTCATT GGAGCCACTGCCAACTTCAGCCGCTTCACCCTGTGGGGTCTGGAGACCATCCCTGGCCCG GATGCCAAAGTGCGTGGGGCCTTAACTTGGCCCAGCCTTGCGGCAGCGATTCACGCACAG GTGCCCGAGGACTGAGAACCAGAGCTTGAAATTCAAAGCTGCGATCCCTTCACAGCAGTA AACCAGCTCTTTGGAACCGATTCCATCACCCCAATAAAGGAGCTCTTCACAGCAAAAAAA AAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_032193 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_032193.3, NP_115569.2 |
| RefSeq Size | 2785 bp |
| RefSeq ORF | 495 bp |
| Locus ID | 84153 |
| UniProt ID | Q8TDP1 |
| Protein Pathways | DNA replication |
| Gene Summary | This gene encodes a ribonuclease H subunit that can cleave ribonucleotides from RNA:DNA duplexes. Mutations in this gene cause Aicardi-Goutieres syndrome-3, a disease that causes severe neurologic dysfunction. A pseudogene for this gene has been identified on chromosome Y, near the sex determining region Y (SRY) gene. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204827 | RNASEH2C (Myc-DDK-tagged)-Human ribonuclease H2, subunit C (RNASEH2C) |
CNY 3,990.00 |
|
| RC204827L3 | Lenti-ORF clone of RNASEH2C (Myc-DDK-tagged)-Human ribonuclease H2, subunit C (RNASEH2C) |
CNY 5,890.00 |
|
| RC204827L4 | Lenti-ORF clone of RNASEH2C (mGFP-tagged)-Human ribonuclease H2, subunit C (RNASEH2C) |
CNY 5,890.00 |
|
| RG204827 | RNASEH2C (tGFP-tagged) - Human ribonuclease H2, subunit C (RNASEH2C) |
CNY 4,370.00 |
其它RNase H2 subunit C产品
