United States
Germany
Japan
United Kingdom
China
G protein alpha S (GNAS) (NM_001077489) Human Untagged Clone
CAT＃: SC315542
GNAS (untagged)-Human GNAS complex locus (GNAS), transcript variant 7
CNY 4,024.00
CNY 6,180.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AHO; C20orf45; GNAS1; GPSA; GSA; GSP; NESP; PITA3; POH; SCG6; SgVI |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC315542 representing NM_001077489.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCTGCCTCGGGAACAGTAAGACCGAGGACCAGCGCAACGAGGAGAAGGCGCAGCGTGAGGCCAAC AAAAAGATCGAGAAGCAGCTGCAGAAGGACAAGCAGGTCTACCGGGCCACGCACCGCCTGCTGCTGCTG GGTGCTGGAGAATCTGGTAAAAGCACCATTGTGAAGCAGATGAGGATCCTGCATGTTAATGGGTTTAAT GGAGATGAGAAGGCAACCAAAGTGCAGGACATCAAAAACAACCTGAAAGAGGCGATTGAAACCATTGTG GCCGCCATGAGCAACCTGGTGCCCCCCGTGGAGCTGGCCAACCCCGAGAACCAGTTCAGAGTGGACTAC ATCCTGAGTGTGATGAACGTGCCTGACTTTGACTTCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTG TGGGAGGATGAAGGAGTGCGTGCCTGCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAG TACTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGACCTGCTTCGC TGCCGTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAAGTCAACTTCCACATGTTT GACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAGTGCTTCAACGATGTGACTGCCATCATC TTCGTGGTGGCCAGCAGCAGCTACAACATGGTCATCCGGGAGGACAACCAGACCAACCGCCTGCAGGAG GCTCTGAACCTCTTCAAGAGCATCTGGAACAACAGATGGCTGCGCACCATCTCTGTGATCCTGTTCCTC AACAAGCAAGATCTGCTCGCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAA TTTGCTCGCTACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGGGCC AAGTACTTCATTCGAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGTCACTACTGCTAC CCTCATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTCAACGACTGCCGTGACATCATT CAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-RsrII |
| ACCN | NM_001077489 |
| Insert Size | 1140 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001077489.3 |
| RefSeq Size | 1949 bp |
| RefSeq ORF | 1140 bp |
| Locus ID | 2778 |
| UniProt ID | O95467 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Calcium signaling pathway, Dilated cardiomyopathy, Gap junction, GnRH signaling pathway, Long-term depression, Melanogenesis, Taste transduction, Vascular smooth muscle contraction, Vibrio cholerae infection |
| MW | 44.2 kDa |
| Gene Summary | This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (7) is biallelically expressed and lacks an alternate in-frame coding exon, compared to variant 1. It encodes isoform g, which lacks an internal segment, compared to isoform GNASL. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216883 | GNAS (Myc-DDK-tagged)-Human GNAS complex locus (GNAS), transcript variant 7 |
CNY 3,656.00 |
|
| RC216883L3 | Lenti ORF clone of Human GNAS complex locus (GNAS), transcript variant 7, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC216883L4 | Lenti ORF clone of Human GNAS complex locus (GNAS), transcript variant 7, mGFP tagged |
CNY 5,890.00 |
|
| RG216883 | GNAS (tGFP-tagged) - Human GNAS complex locus (GNAS), transcript variant 7 |
CNY 4,370.00 |
其它G protein alpha S产品
