NMNAT2 (NM_015039) Human Untagged Clone

CAT#: SC312888

NMNAT2 (untagged)-Human nicotinamide nucleotide adenylyltransferase 2 (NMNAT2), transcript variant 1



  "NM_015039" in other vectors (4)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NMNAT2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1orf15; PNAT2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312888 representing NM_015039.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCGAGACCACCAAGACCCACGTTATCTTGCTCGCCTGCGGCAGCTTCAATCCCATCACCAAAGGG
CACATTCAGATGTTTGAAAGAGCCAGGGATTATCTGCACAAAACTGGAAGGTTTATTGTGATTGGCGGG
ATTGTCTCCCCTGTCCACGACTCCTATGGAAAACAGGGCCTCGTGTCAAGCCGGCACCGTCTCATCATG
TGTCAGCTGGCCGTCCAGAATTCTGATTGGATCAGGGTGGACCCTTGGGAGTGCTACCAGGACACCTGG
CAGACGACCTGCAGCGTGTTGGAACACCACCGGGACCTCATGAAGAGGGTGACTGGCTGCATCCTCTCC
AATGTCAACACACCTTCCATGACACCTGTGATCGGACAGCCACAAAACGAGACCCCCCAGCCCATTTAC
CAGAACAGCAACGTGGCCACCAAGCCCACTGCAGCCAAGATCTTGGGGAAGGTGGGAGAAAGCCTCAGC
CGGATCTGCTGTGTCCGCCCGCCGGTGGAGCGTTTCACCTTTGTAGATGAGAATGCCAATCTGGGCACG
GTGATGCGGTATGAAGAGATTGAGCTACGGATCCTGCTGCTGTGTGGTAGTGACCTGCTGGAGTCCTTC
TGCATCCCAGGGCTCTGGAACGAGGCAGATATGGAGGTGATTGTTGGTGACTTTGGGATTGTGGTGGTG
CCCCGGGATGCAGCCGACACAGACCGAATCATGAATCACTCCTCAATACTCCGCAAATACAAAAACAAC
ATCATGGTGGTGAAGGATGACATCAACCATCCCATGTCTGTTGTCAGCTCAACCAAGAGCAGGCTGGCC
CTGCAGCATGGGGACGGCCATGTTGTGGATTACCTGTCCCAGCCGGTCATCGACTACATCCTCAAAAGC
CAGCTGTACATCAATGCCTCCGGCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_015039
Insert Size 924 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_015039.3
RefSeq Size 5579 bp
RefSeq ORF 924 bp
Locus ID 23057
UniProt ID Q9BZQ4
Domains CTP_transf_2
Protein Pathways Metabolic pathways, Nicotinate and nicotinamide metabolism
MW 34.4 kDa
Gene Summary This gene product belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family, members of which catalyze an essential step in NAD (NADP) biosynthetic pathway. Unlike the other human family member, which is localized to the nucleus, and is ubiquitously expressed; this enzyme is cytoplasmic, and is predominantly expressed in the brain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...