JNK1 (MAPK8) (NM_139047) Human Untagged Clone
CAT#: SC310405
MAPK8 (untagged)-Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b2
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310405 representing NM_139047.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTG AAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCAGCTTATGATGCC ATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGG GCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTC ACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTT TGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGA ATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCT GATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCT TATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAACGTTGAC ATTTGGTCAGTTGGGTGCATCATGGGAGAAATGATCAAAGGTGGTGTTTTGTTCCCAGGTACAGATCAT ATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGAACACCATGTCCTGAATTCATGAAGAAACTGCAA CCAACAGTAAGGACTTACGTTGAAAACAGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCT GATGTCCTTTTCCCAGCTGACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCC AAAATGCTGGTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAAT GTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGATGAAAGG GAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGACTTGGAGGAGAGAACCAAG AATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGGTGCAGCAGTGATCAATGGCTCTCAGCATCCATCA TCATCGTCGTCTGTCAATGATGTGTCTTCAATGTCAACAGATCCGACTTTGGCCTCTGATACAGACAGC AGTCTAGAAGCAGCAGCTGGGCCTCTGGGCTGCTGTAGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_139047 |
Insert Size | 1284 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_139047.1 |
RefSeq Size | 1412 bp |
RefSeq ORF | 1284 bp |
Locus ID | 5599 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase |
Protein Pathways | Adipocytokine signaling pathway, Colorectal cancer, Epithelial cell signaling in Helicobacter pylori infection, ErbB signaling pathway, Fc epsilon RI signaling pathway, Focal adhesion, GnRH signaling pathway, Insulin signaling pathway, MAPK signaling pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway, Type II diabetes mellitus, Wnt signaling pathway |
MW | 48.1 kDa |
Gene Summary | The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016] Transcript Variant: This variant (JNK1-b2) encodes the longer of the two JNK1 beta isoforms (JNK1 beta2). The JNK1-b2 variant differs from the JNK1-a2 variant in the use of an alternate internal coding exon of the same length. Thus, JNK1 beta2 isoform is the same length as JNK1 alpha2 isoform, with a few aa difference in an internal protein segment. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222874 | MAPK8 (Myc-DDK-tagged)-Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b2 |
CNY 3,656.00 |
|
RC222874L1 | Lenti ORF clone of Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b2, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC222874L2 | Lenti ORF clone of Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b2, mGFP tagged |
CNY 6,180.00 |
|
RC222874L3 | Lenti ORF clone of Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b2, Myc-DDK-tagged |
CNY 6,180.00 |
|
RC222874L4 | Lenti ORF clone of Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b2, mGFP tagged |
CNY 6,180.00 |
|
RG222874 | MAPK8 (tGFP-tagged) - Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b2 |
CNY 4,750.00 |