Junctophilin 2 (JPH2) (NM_175913) Human Untagged Clone

CAT#: SC307053

JPH2 (untagged)-Human junctophilin 2 (JPH2), transcript variant 2



  "NM_175913" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
JPH2 mouse monoclonal antibody, clone OTI1F5 (formerly 1F5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMH17; JP-2; JP2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_175913, the custom clone sequence may differ by one or more nucleotides
ATGAGTGGGGGCCGCTTCGACTTTGATGATGGAGGGGCGTACTGCGGGGGCTGGGAGGGG
GGAAAGGCCCATGGGCATGGACTGTGCACAGGCCCCAAGGGCCAGGGCGAATACTCTGGC
TCCTGGAACTTTGGCTTTGAGGTGGCAGGTGTCTACACCTGGCCCAGCGGAAACACCTTT
GAGGGATACTGGAGCCAGGGCAAACGGCATGGGCTGGGCATAGAGACCAAGGGGCGCTGG
CTCTACAAGGGCGAGTGGACACATGGCTTCAAGGGACGCTACGGAATCCGGCAGAGCTCA
AGCAGCGGTGCCAAGTATGAGGGCACCTGGAACAATGGCCTGCAAGACGGCTATGGCACC
GAGACCTATGCTGATGGAGGGATGTGTTAA
Restriction Sites Please inquire     
ACCN NM_175913
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_175913.3, NP_787109.2
RefSeq Size 2408 bp
RefSeq ORF 390 bp
Locus ID 57158
UniProt ID Q9BR39
Protein Families Transmembrane
Gene Summary Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. Alternative splicing has been observed at this locus and two variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1, resulting in a shorter isoform (2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...