OCM2 (NM_006188) Human Untagged Clone
CAT#: SC303745
OCM2 (untagged)-Human oncomodulin 2 (OCM2)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | OCM; OM |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303745 representing NM_006188.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCATCACGGACGTGCTCAGTGCTGATGACATTGCAGCAGCGCTCCAGGAATGCCAAGACCCAGAC ACTTTTGAACCCCAAAAATTCTTCCAGACGTCAGGCCTCTCCAAGATGTCAGCCAGTCAGGTGAAGGAT GTTTTCCGGTTCATAGACAACGACCAGAGCGGGTATCTGGATGAAGAAGAGCTTAAGTTTTTCCTCCAG AAGTTTGAGAGTGGTGCCAGAGAACTGACCGAGTCAGAAACCAAGTCCTTGATGGCTGCGGCGGATAAT GATGGAGATGGGAAAATTGGAGCAGAGGAATTCCAGGAAATGGTGCATTCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_006188 |
Insert Size | 330 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006188.3 |
RefSeq Size | 588 bp |
RefSeq ORF | 330 bp |
Locus ID | 4951 |
UniProt ID | P0CE71 |
MW | 12.1 kDa |
Gene Summary | This gene is similar to the oncomodulin gene, a high-affinity calcium ion-binding protein that belongs to the superfamily of calmodulin proteins, also known as the EF-hand proteins. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224075 | OCM2 (Myc-DDK-tagged)-Human oncomodulin 2 (OCM2) |
CNY 1,200.00 |
|
RC224075L3 | Lenti ORF clone of Human oncomodulin 2 (OCM2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224075L4 | Lenti ORF clone of Human oncomodulin 2 (OCM2), mGFP tagged |
CNY 5,890.00 |
|
RG224075 | OCM2 (tGFP-tagged) - Human oncomodulin 2 (OCM2) |
CNY 2,800.00 |