CD1 (CD1A) (NM_001763) Human Untagged Clone

CAT#: SC303065

CD1A (untagged)-Human CD1a molecule (CD1A)



  "NM_001763" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
CD1a (4C3) Mouse monoclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD1; FCB6; HTA1; R4; T6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303065 representing NM_001763.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGTTTTTGCTACTTCCATTGTTAGCTGTTCTCCCAGGTGATGGCAATGCAGACGGGCTCAAGGAG
CCTCTCTCCTTCCATGTCACCTGGATCGCATCCTTTTACAACCATTCCTGGAAACAAAATCTGGTCTCA
GGTTGGCTGAGTGATTTGCAGACTCATACCTGGGACAGCAATTCCAGCACCATCGTTTTCCTGTGCCCC
TGGTCCAGGGGAAACTTCAGCAATGAGGAGTGGAAGGAACTGGAAACATTATTCCGTATACGCACCATT
CGGTCATTTGAGGGAATTCGTAGATACGCCCATGAATTGCAGTTTGAATATCCTTTTGAGATACAGGTG
ACAGGAGGCTGTGAGCTGCACTCTGGAAAGGTCTCAGGAAGCTTCTTGCAGTTAGCTTATCAAGGATCA
GACTTTGTGAGCTTCCAGAACAATTCATGGTTGCCATATCCAGTGGCTGGGAATATGGCCAAGCATTTC
TGCAAAGTGCTCAATCAGAATCAGCATGAAAATGACATAACACACAATCTTCTCAGTGACACCTGCCCA
CGTTTCATCTTGGGTCTTCTTGATGCAGGAAAGGCACATCTCCAGCGGCAAGTGAAGCCCGAGGCCTGG
CTGTCCCATGGCCCCAGTCCTGGCCCTGGCCATCTGCAGCTTGTGTGCCATGTCTCAGGATTCTACCCA
AAGCCCGTGTGGGTGATGTGGATGCGGGGTGAGCAGGAGCAGCAGGGCACTCAGCGAGGGGACATCTTG
CCCAGTGCTGATGGGACATGGTATCTCCGCGCAACCCTGGAGGTGGCCGCTGGGGAGGCAGCTGACCTG
TCCTGTCGGGTGAAGCACAGCAGTCTAGAGGGCCAGGACATCGTCCTCTACTGGGAGCATCACAGTTCC
GTGGGCTTCATCATCTTGGCGGTGATAGTGCCTTTACTTCTTCTGATAGGTCTTGCGCTTTGGTTCAGG
AAACGCTGTTTCTGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001763
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001763.2
RefSeq Size 2111 bp
RefSeq ORF 984 bp
Locus ID 909
UniProt ID P06126
Protein Families Druggable Genome, Transmembrane
Protein Pathways Hematopoietic cell lineage
MW 37.1 kDa
Gene Summary This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to the plasma membrane and to recycling vesicles of the early endocytic system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...