DcR3 (TNFRSF6B) (NM_032945) Human 3' UTR Clone

CAT#: SC200927

3' UTR clone of tumor necrosis factor receptor superfamily member 6b decoy (TNFRSF6B) transcript variant M68C for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 2 publications.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DcR3 (TNFRSF6B) (NM_032945) Human 3' UTR Clone
Vector pMirTarget
Synonyms DCR3; decoy receptor 3; DJ583P15.1.1; M68; OTTHUMP00000031583; TR6; tumor necrosis factor receptor superfamily, member 6b; tumor necrosis factor receptor superfamily, member 6b, decoy
ACCN NM_032945
Insert Size 151 bp
Sequence Data
>SC200927 3’UTR clone of NM_032945
The sequence shown below is from the reference sequence of NM_032945. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCCGTGAGCGCTTCCTCCCTGTGCACTGATCCTGGCCCCCTCTTATTTATTCTACATCCTTGGCACCC
CACTTGCACTGAAAGAGGCTTTTTTTTAAATAGAAGAAATGAGGTTTCTTAAAGCTTATTTTTATAAAG
CTTTTTCATAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032945.2
Synonyms DCR3; decoy receptor 3; DJ583P15.1.1; M68; OTTHUMP00000031583; TR6; tumor necrosis factor receptor superfamily, member 6b; tumor necrosis factor receptor superfamily, member 6b, decoy
Summary This gene belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-through transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. [provided by RefSeq, Feb 2011]
Locus ID 8771
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Documents

Customer Reviews 
Loading...