Human USH2A activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	USH2A
Locus ID	7399
Kit Components	GA105097G1, USH2A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGTATGCATGATCCCATCC GA105097G2, USH2A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGCTGGTACCTCAAGCAGT GA105097G3, USH2A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGTACCAGCGGAAAGCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_007123, NM_206933
Synonyms	dJ1111A8.1; RP39; US2; USH2
Summary	This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.